ZFIN ID: ZDB-MRPHLNO-121120-5
Morpholino Name: MO1-myh9a
Target: myh9a (1)
Previous Name: zMyh9-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAACTTCTCTGCGTCTGACATTTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-myh9a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-myh9a
Expressed Gene Anatomy Figures
myh9a Fig. 3 from Müller et al., 2011
PHENOTYPE
Phenotype resulting from MO1-myh9a
Phenotype Figures
dorsal aorta distended, abnormal Fig. 4 from Müller et al., 2011
glomerular basement membrane increased thickness, abnormal Fig. S3 with imageFig. S4 with image from Anderson et al., 2015
glomerular basement membrane podocyte foot morphology, abnormal Fig. S4 with image from Anderson et al., 2015
glomerular capillary formation disrupted, abnormal Fig. 4 from Müller et al., 2011
glomerular filtration decreased process quality, abnormal Fig. 4 from Kotb et al., 2014
Fig. 6 from Müller et al., 2011
glomerular filtration decreased rate, abnormal Fig. 4 from Kotb et al., 2014
Fig. 6 from Müller et al., 2011
glomerular filtration disrupted, abnormal Fig. 5 with imageFig. S3 with image from Anderson et al., 2015
glomerulus morphogenesis disrupted, abnormal Fig. 4 from Müller et al., 2011
heart looping disrupted, abnormal text only from Müller et al., 2011
lamina densa surrounding pronephric podocyte cell projection, abnormal Fig. 5 from Müller et al., 2011
pericardium edematous, abnormal Fig. 2 from Müller et al., 2011
podocyte disorganized, abnormal Fig. S4 with image from Anderson et al., 2015
pronephric glomerular basement membrane decreased permeability, abnormal Fig. 5 from Müller et al., 2011
pronephric glomerular basement membrane increased thickness, abnormal Fig. 5 from Müller et al., 2011
pronephric glomerulus morphology, abnormal Fig. 3Fig. 4 from Müller et al., 2011
pronephric podocyte attached to dorsal aorta, abnormal Fig. 4 from Müller et al., 2011
pronephric podocyte cell projection folded, abnormal Fig. 5 from Müller et al., 2011
pronephric podocyte cell projection inserted into pronephric capsular space, abnormal Fig. 5 from Müller et al., 2011
pronephros capillary loop nephron closure incomplete, abnormal Fig. 3 from Müller et al., 2011
pronephros capillary loop nephron decreased amount, abnormal Fig. 4 from Müller et al., 2011
pronephros mesangial cell decreased amount, abnormal Fig. 3 from Müller et al., 2011
pronephros renal glomerulus malformed, abnormal Fig. 4 from Müller et al., 2011
regulation of heart rate disrupted, abnormal text only from Müller et al., 2011
renal glomerulus microvillus protruding into renal capsular space, abnormal Fig. S3 with image from Anderson et al., 2015
whole organism curved dorsal, abnormal Fig. 2 from Müller et al., 2011
whole organism edematous, abnormal Fig. 5 with imageFig. S3 with image from Anderson et al., 2015
whole organism dorsal-ventral axis decreased length, abnormal Fig. 2 from Müller et al., 2011
yolk edematous, abnormal Fig. 2 from Müller et al., 2011

Phenotype of all Fish created by or utilizing MO1-myh9a
Phenotype Fish Conditions Figures
renal glomerulus microvillus protruding into renal capsular space, abnormal AB/EKW + MO1-myh9a standard conditions Fig. S3 with image from Anderson et al., 2015
glomerular basement membrane increased thickness, abnormal AB/EKW + MO1-myh9a standard conditions Fig. S3 with imageFig. S4 with image from Anderson et al., 2015
whole organism edematous, abnormal AB/EKW + MO1-myh9a standard conditions Fig. 5 with imageFig. S3 with image from Anderson et al., 2015
glomerular filtration disrupted, abnormal AB/EKW + MO1-myh9a standard conditions Fig. 5 with imageFig. S3 with image from Anderson et al., 2015
podocyte disorganized, abnormal AB/EKW + MO1-myh9a standard conditions Fig. S4 with image from Anderson et al., 2015
glomerular basement membrane podocyte foot morphology, abnormal AB/EKW + MO1-myh9a standard conditions Fig. S4 with image from Anderson et al., 2015
glomerulus morphogenesis disrupted, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
glomerular filtration decreased process quality, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Kotb et al., 2014
Fig. 6 from Müller et al., 2011
lamina densa surrounding pronephric podocyte cell projection, abnormal WT + MO1-myh9a standard conditions Fig. 5 from Müller et al., 2011
pronephric glomerular basement membrane decreased permeability, abnormal WT + MO1-myh9a standard conditions Fig. 5 from Müller et al., 2011
pronephric podocyte cell projection inserted into pronephric capsular space, abnormal WT + MO1-myh9a standard conditions Fig. 5 from Müller et al., 2011
regulation of heart rate disrupted, abnormal WT + MO1-myh9a standard conditions text only from Müller et al., 2011
dorsal aorta distended, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
whole organism dorsal-ventral axis decreased length, abnormal WT + MO1-myh9a standard conditions Fig. 2 from Müller et al., 2011
glomerular capillary formation disrupted, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
pronephric podocyte cell projection folded, abnormal WT + MO1-myh9a standard conditions Fig. 5 from Müller et al., 2011
heart looping disrupted, abnormal WT + MO1-myh9a standard conditions text only from Müller et al., 2011
whole organism curved dorsal, abnormal WT + MO1-myh9a standard conditions Fig. 2 from Müller et al., 2011
pronephros capillary loop nephron decreased amount, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
pronephric glomerular basement membrane increased thickness, abnormal WT + MO1-myh9a standard conditions Fig. 5 from Müller et al., 2011
glomerular filtration decreased rate, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Kotb et al., 2014
Fig. 6 from Müller et al., 2011
pericardium edematous, abnormal WT + MO1-myh9a standard conditions Fig. 2 from Müller et al., 2011
pronephros renal glomerulus malformed, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
yolk edematous, abnormal WT + MO1-myh9a standard conditions Fig. 2 from Müller et al., 2011
pronephric glomerulus morphology, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
pronephric podocyte attached to dorsal aorta, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
pronephros capillary loop nephron closure incomplete, abnormal li1Tg + MO1-myh9a standard conditions Fig. 3 from Müller et al., 2011
pronephric glomerulus morphology, abnormal li1Tg + MO1-myh9a standard conditions Fig. 3 from Müller et al., 2011
pronephros mesangial cell decreased amount, abnormal li1Tg + MO1-myh9a standard conditions Fig. 3 from Müller et al., 2011
whole organism edematous, abnormal AB/EKW + MO1-myh9a + MO2-apol1 standard conditions Fig. 5 with image from Anderson et al., 2015
glomerular filtration disrupted, abnormal AB/EKW + MO1-myh9a + MO2-apol1 standard conditions Fig. 5 with image from Anderson et al., 2015
glomerular filtration disrupted, abnormal AB/EKW + MO1-myh9a + MO2-apol1 chemical treatment: herbicide Fig. 5 with image from Anderson et al., 2015
glomerular filtration disrupted, abnormal AB/EKW + MO1-myh9a + MO2-apol1 + MO2-atp5if1a standard conditions Fig. 5 with image from Anderson et al., 2015
OTHER MO1-myh9a MORPHOLINO PAGESNo links to external sites
CITATIONS (3)