header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-121120-1
Morpholino Name: MO1-plekho1b
Target: plekho1b (1)
Previous Name: ckip1 MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGGCTCAATGAAACACCGCTTCCCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-plekho1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-plekho1b
Expressed Gene Anatomy Figures
prox1a Fig. 2 with image from Baas et al., 2012
PHENOTYPE
Phenotype resulting from MO1-plekho1b
Phenotype of all Fish created by or utilizing MO1-plekho1b
OTHER MO1-plekho1b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)