header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-121119-5
Morpholino Name: MO2-pmm2
Target: pmm2 (1)
Sequence:
5' - TTCCGCATTAATTCACTCACTTGAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-pmm2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-pmm2 No data available
PHENOTYPE
Phenotype resulting from MO2-pmm2
Phenotype of all Fish created by or utilizing MO2-pmm2
Phenotype Fish Conditions Figures
pectoral fin kinked, abnormal WT + MO2-pmm2 standard conditions Fig. 2 from Cline et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO2-pmm2 standard conditions Fig. 3 from Cline et al., 2012
palatoquadrate cartilage decreased length, abnormal WT + MO2-pmm2 standard conditions Fig. 2 from Cline et al., 2012
Meckel's cartilage morphology, abnormal WT + MO2-pmm2 standard conditions Fig. 2 from Cline et al., 2012
whole organism circling, abnormal WT + MO2-pmm2 standard conditions Fig. 3 from Cline et al., 2012
protein N-linked glycosylation decreased occurrence, abnormal WT + MO2-pmm2 standard conditions Fig. 5 from Cline et al., 2012
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal WT + MO2-pmm2 standard conditions Fig. 2 from Cline et al., 2012
cartilage morphogenesis disrupted, abnormal WT + MO2-pmm2 standard conditions Fig. 2 from Cline et al., 2012
lipooligosaccharide catabolic process increased occurrence, abnormal WT + MO2-pmm2 standard conditions Fig. 5 from Cline et al., 2012
swimming behavior decreased process quality, abnormal WT + MO2-pmm2 standard conditions Fig. 3 from Cline et al., 2012
palatoquadrate cartilage shape, abnormal WT + MO2-pmm2 standard conditions Fig. 2 from Cline et al., 2012
ceratohyal cartilage morphology, abnormal WT + MO2-pmm2 standard conditions Fig. 2 from Cline et al., 2012
spinal cord secondary motor neuron increased amount, abnormal ml2Tg + MO2-pmm2 standard conditions Fig. 4 from Cline et al., 2012
swimming behavior decreased process quality, abnormal WT + MO1-mpi + MO2-pmm2 standard conditions Fig. 8 from Cline et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO1-mpi + MO2-pmm2 standard conditions Fig. 8 from Cline et al., 2012
OTHER MO2-pmm2 MORPHOLINO PAGES No links to external sites
CITATIONS (1)