ZFIN ID: ZDB-MRPHLNO-121106-3
Morpholino Name: MO5-foxi1
Target: foxi1 (1)
Sequence:
5' - GAGTTTCTCCGATCTGACCTGCTGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-foxi1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-foxi1 No data available
PHENOTYPE
Phenotype resulting from MO5-foxi1
No data available

Phenotype of all Fish created by or utilizing MO5-foxi1
No data available
OTHER MO5-foxi1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)