ZFIN ID: ZDB-MRPHLNO-121019-1
Morpholino Name: MO3-enpp2
Target: enpp2 (1)
Previous Name: atx TL MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGCGTCTGGTGGCTCTCTTCCACAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-enpp2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-enpp2
Expressed Gene Anatomy Figures
cldnk Fig. 6 from Yuelling et al., 2012
enpp2 Fig. 3 from Yuelling et al., 2012
mbpa Fig. 5 from Yuelling et al., 2012
olig1 Fig. 7 from Yuelling et al., 2012
olig2 Fig. 8 from Yuelling et al., 2012
sox10 Fig. 8 from Yuelling et al., 2012
PHENOTYPE
Phenotype resulting from MO3-enpp2
Phenotype of all Fish created by or utilizing MO3-enpp2
Genome Resources:
CITATIONS (1)