ZFIN ID: ZDB-MRPHLNO-120928-2
Morpholino Name: MO2-vps37a
Target: vps37a (1)
Previous Name: vps37a_MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCTGCAATACTATAGAGACATTATA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-vps37a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-vps37a No data available
PHENOTYPE
Phenotype resulting from MO2-vps37a
Phenotype Figures
whole organism decreased mobility, abnormal Fig. 4 from Zivony-Elboum et al., 2012

Phenotype of all Fish created by or utilizing MO2-vps37a
Phenotype Fish Conditions Figures
whole organism decreased mobility, abnormal AB/TL + MO2-vps37a standard conditions Fig. 4 from Zivony-Elboum et al., 2012
OTHER MO2-vps37a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)