ZFIN ID: ZDB-MRPHLNO-120928-1
Morpholino Name: MO1-vps37a
Target: vps37a (1)
Previous Name: vps37a_ATG_MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGGAAAATCCAGTTCATTCTCGGCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-vps37a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-vps37a No data available
PHENOTYPE
Phenotype resulting from MO1-vps37a
No data available

Phenotype of all Fish created by or utilizing MO1-vps37a
No data available
OTHER MO1-vps37a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)