header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120912-6
Morpholino Name: MO5-dmd
Target: dmd (1)
Previous Name: Z32E(+ 133+ 157)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTGACTGCACCACTTCCTGCTCCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Exon-skipping MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-dmd No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-dmd No data available
PHENOTYPE
Phenotype resulting from MO5-dmd
No data available

Phenotype of all Fish created by or utilizing MO5-dmd
No data available
Genome Resources:
CITATIONS (1)