header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120911-7
Morpholino Name: MO2-arxa
Target: arxa (1)
Previous Name: MO2-arx

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATCGTCGTCGTACTGACTGCTCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-arxa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-arxa
Expressed Gene Anatomy Figures
ascl1a Fig. 7 with image from Filippi et al., 2012
ddc Fig. 5 with image from Filippi et al., 2012
gad1b Fig. 7 with image from Filippi et al., 2012
lhx1a Fig. 7 with image from Filippi et al., 2012
nkx2.2a Fig. 7 with image from Filippi et al., 2012
olig2 Fig. 7 with image from Filippi et al., 2012
pax6a Fig. 7 with image from Filippi et al., 2012
slc6a3 Fig. 5 with image from Filippi et al., 2012
th Fig. 5 with image from Filippi et al., 2012
PHENOTYPE
Phenotype resulting from MO2-arxa
Phenotype of all Fish created by or utilizing MO2-arxa
OTHER MO2-arxa MORPHOLINO PAGES No links to external sites
CITATIONS (1)