ZFIN ID: ZDB-MRPHLNO-120906-2
Morpholino Name: MO2-ddx18
Target: ddx18 (1)
Sequence:
5' - GAATCTTCATCTGCATGTCCGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ddx18 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ddx18 No data available
PHENOTYPE
Phenotype resulting from MO2-ddx18
No data available

Phenotype of all Fish created by or utilizing MO2-ddx18
No data available
OTHER MO2-ddx18 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)