ZFIN ID: ZDB-MRPHLNO-120906-1
Morpholino Name: MO1-ddx18
Target: ddx18 (1)
Sequence:
5' - AGCATCATTAAACACTCACTGGATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ddx18 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ddx18 No data available
PHENOTYPE
Phenotype resulting from MO1-ddx18
Phenotype Figures
myeloid cell decreased amount, abnormal Fig. S2 from Payne et al., 2011

Phenotype of all Fish created by or utilizing MO1-ddx18
Phenotype Fish Conditions Figures
myeloid cell decreased amount, abnormal WT + MO1-ddx18 standard conditions Fig. S2 from Payne et al., 2011
OTHER MO1-ddx18 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)