Morpholino

MO1-smyd2b

ID

ZDB-MRPHLNO-120824-3

Name

MO1-smyd2b

Previous Names

None

Target

smyd2b (1)

Sequence

5' - GGGATGCCTTCTGCCTTCATCATAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-smyd2b

No data available

Phenotype

Phenotype resulting from MO1-smyd2b

No data available

Phenotype of all Fish created by or utilizing MO1-smyd2b

Phenotype	Fish	Conditions	Figures
heart decreased contractility, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Voelkel et al., 2013
atrium malformed, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Voelkel et al., 2013
post-vent region increased curvature, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Donlin et al., 2012
whole organism decreased mobility, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	text only from Donlin et al., 2012
peptidyl-lysine methylation decreased occurrence, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Donlin et al., 2012
pericardium edematous, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Donlin et al., 2012
heart decreased functionality, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Voelkel et al., 2013
heart contraction decreased rate, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	text only from Donlin et al., 2012
sinus venosus edematous, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Donlin et al., 2012
cardiac ventricle malformed, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Voelkel et al., 2013
skeletal muscle morphology, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	text only from Voelkel et al., 2013
heart elongated, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Donlin et al., 2012
post-vent region increased curvature, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
atrium malformed, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Voelkel et al., 2013
peptidyl-lysine methylation decreased occurrence, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
skeletal muscle morphology, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	text only from Voelkel et al., 2013
heart contraction decreased rate, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	text only from Donlin et al., 2012
whole organism decreased mobility, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	text only from Donlin et al., 2012
heart decreased functionality, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Voelkel et al., 2013
heart decreased contractility, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Voelkel et al., 2013
pericardium edematous, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
cardiac ventricle malformed, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Voelkel et al., 2013
heart elongated, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
sinus venosus edematous, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012

Citations