ZFIN ID: ZDB-MRPHLNO-120424-5
Morpholino Name: MO1-unc119b
Target: unc119b (1)
Sequence:
5' - GCTGGTACAAGAATAGCTCATTATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-unc119b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-unc119b No data available
PHENOTYPE
Phenotype resulting from MO1-unc119b
Phenotype Figures
Kupffer's vesicle morphology, abnormal Fig. 6 from Wright et al., 2011

Phenotype of all Fish created by or utilizing MO1-unc119b
Phenotype Fish Conditions Figures
Kupffer's vesicle morphology, abnormal WT + MO1-unc119b standard conditions Fig. 6 from Wright et al., 2011
OTHER MO1-unc119b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)