Morpholino

MO1-hs2st1a

ID
ZDB-MRPHLNO-120420-1
Name
MO1-hs2st1a
Previous Names
  • 2-OST MO1 (1)
Target
Sequence
5' - TGACCGAGAACTTTATTACACACAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO. Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hs2st1a
Expressed Gene Anatomy Figures
hs2st1a Fig. 2 with image from Cadwalader et al., 2012
Phenotype
Phenotype resulting from MO1-hs2st1a
Phenotype Fish Figures
blastoderm cell increased size, abnormal AB + MO1-hs2st1a Fig. 7 with image from Cadwalader et al., 2012
cell migration involved in gastrulation disrupted, abnormal AB + MO1-hs2st1a Fig. 1 with image from Cadwalader et al., 2012
cell population proliferation decreased occurrence, abnormal AB + MO1-hs2st1a Fig. 7 with image from Cadwalader et al., 2012
cell-cell adhesion decreased process quality, abnormal AB + MO1-hs2st1a Fig. S1 with image from Cadwalader et al., 2012
cell-cell adhesion mediated by cadherin decreased process quality, abnormal AB + MO1-hs2st1a Fig. 4 with image from Cadwalader et al., 2012
deep blastomere cellular adhesivity, abnormal AB + MO1-hs2st1a Fig. 4 with image from Cadwalader et al., 2012
deep blastomere circular, abnormal AB + MO1-hs2st1a Fig. 4 with image from Cadwalader et al., 2012
epiboly involved in gastrulation with mouth forming second arrested, abnormal AB + MO1-hs2st1a Fig. 1 with image from Cadwalader et al., 2012
EVL cellular motility, abnormal AB + MO1-hs2st1a Fig. 1 with image from Cadwalader et al., 2012
protein localization to adherens junction disrupted, abnormal AB + MO1-hs2st1a Fig. 4 with image from Cadwalader et al., 2012
whole organism broken, abnormal AB + MO1-hs2st1a text only from Cadwalader et al., 2012
Phenotype of all Fish created by or utilizing MO1-hs2st1a
Phenotype Fish Conditions Figures
deep blastomere cellular adhesivity, abnormal AB + MO1-hs2st1a standard conditions Fig. 4 with image from Cadwalader et al., 2012
whole organism broken, abnormal AB + MO1-hs2st1a standard conditions text only from Cadwalader et al., 2012
protein localization to adherens junction disrupted, abnormal AB + MO1-hs2st1a standard conditions Fig. 4 with image from Cadwalader et al., 2012
cell-cell adhesion mediated by cadherin decreased process quality, abnormal AB + MO1-hs2st1a standard conditions Fig. 4 with image from Cadwalader et al., 2012
cell migration involved in gastrulation disrupted, abnormal AB + MO1-hs2st1a standard conditions Fig. 1 with image from Cadwalader et al., 2012
blastoderm cell increased size, abnormal AB + MO1-hs2st1a standard conditions Fig. 7 with image from Cadwalader et al., 2012
epiboly involved in gastrulation with mouth forming second arrested, abnormal AB + MO1-hs2st1a standard conditions Fig. 1 with image from Cadwalader et al., 2012
deep blastomere circular, abnormal AB + MO1-hs2st1a standard conditions Fig. 4 with image from Cadwalader et al., 2012
EVL cellular motility, abnormal AB + MO1-hs2st1a standard conditions Fig. 1 with image from Cadwalader et al., 2012
cell population proliferation decreased occurrence, abnormal AB + MO1-hs2st1a standard conditions Fig. 7 with image from Cadwalader et al., 2012
cell-cell adhesion decreased process quality, abnormal AB + MO1-hs2st1a standard conditions Fig. S1 with image from Cadwalader et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.