ZFIN ID: ZDB-MRPHLNO-120326-1
Morpholino Name: MO2-rfx2
Target: rfx2 (1)
Previous Name: rfx2 AUGMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCTTCTGACCGCTGCATGGTTTCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-rfx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-rfx2
Expressed Gene Anatomy Figures
lft1 Fig. 3 with image from Bisgrove et al., 2012
lft2 Fig. 3 with image from Bisgrove et al., 2012
myod1 Fig. 3 with image from Bisgrove et al., 2012
spaw Fig. 3 with image from Bisgrove et al., 2012
PHENOTYPE
Phenotype resulting from MO2-rfx2
Phenotype of all Fish created by or utilizing MO2-rfx2
Phenotype Fish Conditions Figures
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO2-rfx2 standard conditions Fig. 4 with image from Bisgrove et al., 2012
heart symmetry, abnormal WT + MO2-rfx2 standard conditions Fig. 2 with imageFig. 3 with image from Bisgrove et al., 2012
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO2-rfx2 standard conditions Fig. 2 with imageFig. 3 with image from Bisgrove et al., 2012
Kupffer's vesicle development decreased process quality, abnormal WT + MO2-rfx2 standard conditions Fig. 4 with image from Bisgrove et al., 2012
determination of liver left/right asymmetry decreased process quality, abnormal WT + MO2-rfx2 standard conditions Fig. 2 with image from Bisgrove et al., 2012
Kupffer's vesicle decreased functionality, abnormal WT + MO2-rfx2 standard conditions Fig. 4 with image from Bisgrove et al., 2012
motile cilium assembly decreased process quality, abnormal WT + MO2-rfx2 standard conditions Fig. 4 with image from Bisgrove et al., 2012
liver symmetry, abnormal WT + MO2-rfx2 standard conditions Fig. 2 with image from Bisgrove et al., 2012
determination of left/right symmetry decreased process quality, abnormal WT + MO2-rfx2 standard conditions Fig. 2 with image from Bisgrove et al., 2012
gut symmetry, abnormal WT + MO2-rfx2 standard conditions Fig. 2 with image from Bisgrove et al., 2012
determination of intestine left/right asymmetry decreased process quality, abnormal WT + MO2-rfx2 standard conditions Fig. 2 with image from Bisgrove et al., 2012
heart looping decreased process quality, abnormal WT + MO2-rfx2 standard conditions Fig. 2 with image from Bisgrove et al., 2012
Genome Resources:
CITATIONS (1)