Morpholino

MO2-rfx2

ID

ZDB-MRPHLNO-120326-1

Name

MO2-rfx2

Previous Names

rfx2 AUGMO (1)

Target

rfx2 (1)

Sequence

5' - CCTTCTGACCGCTGCATGGTTTCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-rfx2

Expressed Gene	Anatomy	Figures
lft1	diencephalon right side notochord	Fig. 3 from Bisgrove et al., 2012
lft2	heart rudiment left side	Fig. 3 from Bisgrove et al., 2012
myod1	somite	Fig. 3 from Bisgrove et al., 2012
spaw	lateral plate mesoderm left side	Fig. 3 from Bisgrove et al., 2012

Phenotype

Phenotype resulting from MO2-rfx2

Phenotype	Fish	Figures
determination of heart left/right asymmetry decreased process quality, abnormal	WT + MO2-rfx2	Fig. 2 , Fig. 3 from Bisgrove et al., 2012
determination of intestine left/right asymmetry decreased process quality, abnormal	WT + MO2-rfx2	Fig. 2 from Bisgrove et al., 2012
determination of left/right symmetry decreased process quality, abnormal	WT + MO2-rfx2	Fig. 2 from Bisgrove et al., 2012
determination of liver left/right asymmetry decreased process quality, abnormal	WT + MO2-rfx2	Fig. 2 from Bisgrove et al., 2012
gut symmetry, abnormal	WT + MO2-rfx2	Fig. 2 from Bisgrove et al., 2012
heart symmetry, abnormal	WT + MO2-rfx2	Fig. 2 , Fig. 3 from Bisgrove et al., 2012
heart looping decreased process quality, abnormal	WT + MO2-rfx2	Fig. 2 from Bisgrove et al., 2012
Kupffer's vesicle decreased functionality, abnormal	WT + MO2-rfx2	Fig. 4 from Bisgrove et al., 2012
Kupffer's vesicle motile cilium decreased length, abnormal	WT + MO2-rfx2	Fig. 4 from Bisgrove et al., 2012
Kupffer's vesicle development decreased process quality, abnormal	WT + MO2-rfx2	Fig. 4 from Bisgrove et al., 2012
liver symmetry, abnormal	WT + MO2-rfx2	Fig. 2 from Bisgrove et al., 2012
motile cilium assembly decreased process quality, abnormal	WT + MO2-rfx2	Fig. 4 from Bisgrove et al., 2012

Phenotype of all Fish created by or utilizing MO2-rfx2

Phenotype	Fish	Conditions	Figures
Kupffer's vesicle motile cilium decreased length, abnormal	WT + MO2-rfx2	standard conditions	Fig. 4 from Bisgrove et al., 2012
heart symmetry, abnormal	WT + MO2-rfx2	standard conditions	Fig. 2 , Fig. 3 from Bisgrove et al., 2012
determination of heart left/right asymmetry decreased process quality, abnormal	WT + MO2-rfx2	standard conditions	Fig. 2 , Fig. 3 from Bisgrove et al., 2012
Kupffer's vesicle development decreased process quality, abnormal	WT + MO2-rfx2	standard conditions	Fig. 4 from Bisgrove et al., 2012
determination of liver left/right asymmetry decreased process quality, abnormal	WT + MO2-rfx2	standard conditions	Fig. 2 from Bisgrove et al., 2012
Kupffer's vesicle decreased functionality, abnormal	WT + MO2-rfx2	standard conditions	Fig. 4 from Bisgrove et al., 2012
motile cilium assembly decreased process quality, abnormal	WT + MO2-rfx2	standard conditions	Fig. 4 from Bisgrove et al., 2012
liver symmetry, abnormal	WT + MO2-rfx2	standard conditions	Fig. 2 from Bisgrove et al., 2012
determination of left/right symmetry decreased process quality, abnormal	WT + MO2-rfx2	standard conditions	Fig. 2 from Bisgrove et al., 2012
gut symmetry, abnormal	WT + MO2-rfx2	standard conditions	Fig. 2 from Bisgrove et al., 2012
determination of intestine left/right asymmetry decreased process quality, abnormal	WT + MO2-rfx2	standard conditions	Fig. 2 from Bisgrove et al., 2012
heart looping decreased process quality, abnormal	WT + MO2-rfx2	standard conditions	Fig. 2 from Bisgrove et al., 2012

Citations