header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120320-13
Morpholino Name: MO1-nfe2l2b
Target: nfe2l2b (1)
Sequence:
5' - AGCTGAAAGGTCGTCCATGTCTTCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-nfe2l2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-nfe2l2b
Expressed Gene Anatomy Figures
atf3 Fig. 6 from Timme-Laragy et al., 2012
ccng1 Fig. 8 from Timme-Laragy et al., 2012
gstp1 Fig. 6 from Timme-Laragy et al., 2012
hmox1a Fig. 8 from Timme-Laragy et al., 2012
hsp70l Fig. 8 from Sant et al., 2017
Fig. 6 from Timme-Laragy et al., 2012
mitfa Fig. 6 from Timme-Laragy et al., 2012
tp53 Fig. 8 from Timme-Laragy et al., 2012
PHENOTYPE
Phenotype resulting from MO1-nfe2l2b
Phenotype of all Fish created by or utilizing MO1-nfe2l2b
OTHER MO1-nfe2l2b MORPHOLINO PAGESNo links to external sites
CITATIONS (3)