Morpholino

MO2-slc2a10

ID

ZDB-MRPHLNO-120319-6

Name

MO2-slc2a10

Previous Names

splice-MO (1)

Target

slc2a10 (1)

Sequence

5' - CAAATAAAGTCCACTTACTTGGTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-slc2a10

No data available

Phenotype

Phenotype resulting from MO2-slc2a10

Phenotype	Fish	Figures
blood circulation disrupted, abnormal	AB + MO2-slc2a10	text only from Willaert et al., 2012
caudal vein plexus irregular spatial pattern, abnormal	y1Tg + MO2-slc2a10	Fig. 2 from Willaert et al., 2012
heart contraction decreased rate, abnormal	AB + MO2-slc2a10	Fig. 7 from Willaert et al., 2012
notochord bent, abnormal	AB + MO2-slc2a10	Fig. 7 from Willaert et al., 2012
notochord curved, abnormal	AB + MO2-slc2a10	Fig. 2 from Willaert et al., 2012
notochord kinked, abnormal	AB + MO2-slc2a10	Fig. 2 from Willaert et al., 2012
pericardium edematous, abnormal	AB + MO2-slc2a10	Fig. 7 from Willaert et al., 2012
post-vent region undulate, abnormal	AB + MO2-slc2a10	Fig. 2 from Willaert et al., 2012
sinus venosus increased accumulation blood, abnormal	AB + MO2-slc2a10	Fig. 2 from Willaert et al., 2012
vasculature irregular spatial pattern, abnormal	y1Tg + MO2-slc2a10	Fig. 2 from Willaert et al., 2012
vasculature development arrested, abnormal	y1Tg + MO2-slc2a10	Fig. 2 from Willaert et al., 2012
whole organism decreased length, abnormal	AB + MO2-slc2a10	Fig. 7 from Willaert et al., 2012
whole organism mitochondrion decreased functionality, abnormal	AB + MO2-slc2a10	Fig. 6 from Willaert et al., 2012

Phenotype of all Fish created by or utilizing MO2-slc2a10

Phenotype	Fish	Conditions	Figures
heart contraction decreased rate, abnormal	AB + MO2-slc2a10	standard conditions	Fig. 7 from Willaert et al., 2012
whole organism mitochondrion decreased functionality, abnormal	AB + MO2-slc2a10	standard conditions	Fig. 6 from Willaert et al., 2012
notochord kinked, abnormal	AB + MO2-slc2a10	standard conditions	Fig. 2 from Willaert et al., 2012
post-vent region undulate, abnormal	AB + MO2-slc2a10	standard conditions	Fig. 2 from Willaert et al., 2012
whole organism decreased length, abnormal	AB + MO2-slc2a10	standard conditions	Fig. 7 from Willaert et al., 2012
notochord bent, abnormal	AB + MO2-slc2a10	standard conditions	Fig. 7 from Willaert et al., 2012
blood circulation disrupted, abnormal	AB + MO2-slc2a10	standard conditions	text only from Willaert et al., 2012
pericardium edematous, abnormal	AB + MO2-slc2a10	standard conditions	Fig. 7 from Willaert et al., 2012
sinus venosus increased accumulation blood, abnormal	AB + MO2-slc2a10	standard conditions	Fig. 2 from Willaert et al., 2012
notochord curved, abnormal	AB + MO2-slc2a10	standard conditions	Fig. 2 from Willaert et al., 2012
caudal vein plexus irregular spatial pattern, abnormal	y1Tg + MO2-slc2a10	standard conditions	Fig. 2 from Willaert et al., 2012
vasculature development arrested, abnormal	y1Tg + MO2-slc2a10	standard conditions	Fig. 2 from Willaert et al., 2012
vasculature irregular spatial pattern, abnormal	y1Tg + MO2-slc2a10	standard conditions	Fig. 2 from Willaert et al., 2012
heart contraction decreased rate, abnormal	AB + MO1-smad7 + MO2-slc2a10	standard conditions	Fig. 7 from Willaert et al., 2012

Citations