ZFIN ID: ZDB-MRPHLNO-120312-2
Morpholino Name: MO2-orai1b
Target: orai1b (1)
Previous Names: MO-ORAI1 (1), ORAI1 exon 1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAACAGCGCGGAGACTCACCATTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-orai1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-orai1b
Expressed Gene Anatomy Figures
nppa Fig. 3 from Völkers et al., 2012
PHENOTYPE
Phenotype resulting from MO2-orai1b
Phenotype of all Fish created by or utilizing MO2-orai1b
Phenotype Fish Conditions Figures
myotome myofibril detached from vertical myoseptum, abnormal WT + MO2-orai1b standard conditions Fig. 2 from Völkers et al., 2012
cardiac muscle cell sarcomere decreased amount, abnormal WT + MO2-orai1b standard conditions Fig. 2 from Völkers et al., 2012
heart physical object quality, abnormal WT + MO2-orai1b standard conditions Fig. 3 from Völkers et al., 2012
vertical myoseptum malformed, abnormal WT + MO2-orai1b standard conditions Fig. 2 from Völkers et al., 2012
skeletal muscle cell myofibril disorganized, abnormal WT + MO2-orai1b standard conditions Fig. 2 from Völkers et al., 2012
heart contraction decreased rate, abnormal WT + MO2-orai1b standard conditions Fig. 1 from Völkers et al., 2012
skeletal muscle cell Z disc decreased amount, abnormal WT + MO2-orai1b standard conditions Fig. 2 from Völkers et al., 2012
sarcomere organization decreased process quality, abnormal WT + MO2-orai1b standard conditions Fig. 2 from Völkers et al., 2012
detection of muscle stretch process quality, abnormal WT + MO2-orai1b standard conditions Fig. 3 from Völkers et al., 2012
blood circulation decreased rate, abnormal WT + MO2-orai1b standard conditions Fig. 1 from Völkers et al., 2012
cardiac muscle cell Z disc malformed, abnormal WT + MO2-orai1b standard conditions Fig. 2 from Völkers et al., 2012
cardiac muscle cell sarcomere decreased thickness, abnormal WT + MO2-orai1b standard conditions Fig. 2 from Völkers et al., 2012
heart contraction decreased magnitude, abnormal WT + MO2-orai1b standard conditions Fig. 1 from Völkers et al., 2012
heart edematous, abnormal WT + MO2-orai1b standard conditions Fig. 1 from Völkers et al., 2012
Genome Resources:
CITATIONS (1)