header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120302-10
Morpholino Name: MO1-mir221
Target: mir221 (1)
Sequence:
5' - GAAACCCAGCAGACAATGTAGCTGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mir221 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mir221 No data available
PHENOTYPE
Phenotype resulting from MO1-mir221
Phenotype of all Fish created by or utilizing MO1-mir221
Phenotype Fish Conditions Figures
primordial hindbrain channel blood vessel development arrested, abnormal la116Tg + MO1-mir221 standard conditions Fig. 1 with image from Nicoli et al., 2012
intersegmental vessel blood vessel development arrested, abnormal la116Tg + MO1-mir221 standard conditions Fig. 1 with image from Nicoli et al., 2012
thoracic duct aplastic, abnormal y1Tg + MO1-mir221 standard conditions Fig. 1 with image from Nicoli et al., 2012
intersegmental vessel nucleus decreased amount, abnormal s916Tg; y7Tg + MO1-mir221 standard conditions Fig. 5 with imageFig. 8 with image from Nicoli et al., 2012
dorsal longitudinal anastomotic vessel angiogenesis delayed, abnormal s916Tg; y7Tg + MO1-mir221 standard conditions Fig. 3 with image from Nicoli et al., 2012
intersegmental vessel angiogenesis delayed, abnormal s916Tg; y7Tg + MO1-mir221 standard conditions Fig. 3 with image from Nicoli et al., 2012
endothelial tip cell decreased amount, abnormal s916Tg; y7Tg + MO1-mir221 standard conditions Fig. 3 with image from Nicoli et al., 2012
intersegmental vessel decreased length, abnormal s916Tg; y7Tg + MO1-mir221 standard conditions Fig. 5 with imageFig. 8 with image from Nicoli et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO1-flt4 + MO1-mir221 standard conditions Fig. 2 with image from Nicoli et al., 2012
intersegmental vessel decreased length, abnormal s916Tg; y7Tg + MO1-cdkn1bb + MO1-mir221 standard conditions Fig. 8 with image from Nicoli et al., 2012
intersegmental vessel nucleus decreased amount, abnormal s916Tg; y7Tg + MO1-mir221 + MO1-pik3r1 standard conditions Fig. 8 with image from Nicoli et al., 2012
intersegmental vessel decreased length, abnormal s916Tg; y7Tg + MO1-mir221 + MO1-pik3r1 standard conditions Fig. 8 with image from Nicoli et al., 2012
intersegmental vessel decreased length, abnormal s916Tg; y7Tg + MO1-mir221 + MO2-dll4 standard conditions Fig. 5 with image from Nicoli et al., 2012
intersegmental vessel nucleus decreased amount, abnormal s916Tg; y7Tg + MO1-mir221 + MO2-dll4 standard conditions Fig. 5 with image from Nicoli et al., 2012
OTHER MO1-mir221 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)