header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120228-2
Morpholino Name: MO1-xirp2a
Target: xirp2a (1)
Sequence:
5' - CTTTATTTTTACCTTGATATGTTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-xirp2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-xirp2a No data available
PHENOTYPE
Phenotype resulting from MO1-xirp2a
No data available

Phenotype of all Fish created by or utilizing MO1-xirp2a
No data available
OTHER MO1-xirp2a MORPHOLINO PAGES No links to external sites
CITATIONS (1)