ZFIN ID: ZDB-MRPHLNO-120227-2
Morpholino Name: MO2-pak4
Target: pak4 (1)
Sequence:
5' - TTCCTGTGTGTTGCACCAACCTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-pak4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-pak4 No data available
PHENOTYPE
Phenotype resulting from MO2-pak4
Phenotype Figures
blood accumulation trunk vasculature, abnormal Fig. 5Fig. S6 from Fiedler et al., 2011
blood accumulation cranial vasculature, abnormal Fig. S6 from Fiedler et al., 2011
blood circulation disrupted, abnormal Fig. S6 from Fiedler et al., 2011
intersegmental vein absent, abnormal Fig. 5 from Fiedler et al., 2011
pericardium edematous, abnormal Fig. 5 from Fiedler et al., 2011

Phenotype of all Fish created by or utilizing MO2-pak4
Phenotype Fish Conditions Figures
blood circulation disrupted, abnormal s843Tg + MO2-pak4 standard conditions Fig. S6 from Fiedler et al., 2011
blood accumulation cranial vasculature, abnormal s843Tg + MO2-pak4 standard conditions Fig. S6 from Fiedler et al., 2011
intersegmental vein absent, abnormal s843Tg + MO2-pak4 standard conditions Fig. 5 from Fiedler et al., 2011
pericardium edematous, abnormal s843Tg + MO2-pak4 standard conditions Fig. 5 from Fiedler et al., 2011
blood accumulation trunk vasculature, abnormal s843Tg + MO2-pak4 standard conditions Fig. 5Fig. S6 from Fiedler et al., 2011
OTHER MO2-pak4 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)