ZFIN ID: ZDB-MRPHLNO-120222-9
Morpholino Name: MO5-rp2
Target: rp2 (1)
Previous Name: MO_Spl (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCGTCACAAATAAGTTCTAACCTCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-rp2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-rp2 No data available
PHENOTYPE
Phenotype resulting from MO5-rp2
Phenotype Figures
brain hydrocephalic, abnormal Fig. 6 from Desvignes et al., 2015
pericardium edematous, abnormal Fig. 6 from Desvignes et al., 2015

Phenotype of all Fish created by or utilizing MO5-rp2
Phenotype Fish Conditions Figures
pericardium edematous, abnormal AB + MO5-rp2 standard conditions Fig. 6 from Desvignes et al., 2015
brain hydrocephalic, abnormal AB + MO5-rp2 standard conditions Fig. 6 from Desvignes et al., 2015
OTHER MO5-rp2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)