ZFIN ID: ZDB-MRPHLNO-120222-8
Morpholino Name: MO4-rp2
Target: rp2 (1)
Previous Name: MO_ATG (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGGAGAAGAAGCACCCCATTTATGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-rp2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-rp2 No data available
PHENOTYPE
Phenotype resulting from MO4-rp2
Phenotype Figures
apoptotic process increased occurrence, abnormal Fig. 5 from Shu et al., 2011
extension decreased width, abnormal Fig. 3 from Shu et al., 2011
eye decreased size, abnormal Fig. 3 from Shu et al., 2011
eye opaque, abnormal Fig. 3 from Shu et al., 2011
midbrain hindbrain boundary blurry, abnormal Fig. 3 from Shu et al., 2011
post-vent region curved, abnormal Fig. 3 from Shu et al., 2011
retina layer formation disrupted, abnormal Fig. 4 from Shu et al., 2011
retinal cone cell photoreceptor outer segment absent, abnormal Fig. 4 from Shu et al., 2011
retinal ganglion cell layer absent, abnormal Fig. 4 from Shu et al., 2011
retinal inner nuclear layer absent, abnormal Fig. 4 from Shu et al., 2011
retinal outer nuclear layer absent, abnormal Fig. 4 from Shu et al., 2011
retinal rod cell photoreceptor outer segment absent, abnormal Fig. 4 from Shu et al., 2011

Phenotype of all Fish created by or utilizing MO4-rp2
Phenotype Fish Conditions Figures
retinal outer nuclear layer absent, abnormal AB + MO4-rp2 standard conditions Fig. 4 from Shu et al., 2011
eye decreased size, abnormal AB + MO4-rp2 standard conditions Fig. 3 from Shu et al., 2011
extension decreased width, abnormal AB + MO4-rp2 standard conditions Fig. 3 from Shu et al., 2011
retinal ganglion cell layer absent, abnormal AB + MO4-rp2 standard conditions Fig. 4 from Shu et al., 2011
post-vent region curved, abnormal AB + MO4-rp2 standard conditions Fig. 3 from Shu et al., 2011
retinal inner nuclear layer absent, abnormal AB + MO4-rp2 standard conditions Fig. 4 from Shu et al., 2011
apoptotic process increased occurrence, abnormal AB + MO4-rp2 standard conditions Fig. 5 from Shu et al., 2011
retina layer formation disrupted, abnormal AB + MO4-rp2 standard conditions Fig. 4 from Shu et al., 2011
midbrain hindbrain boundary blurry, abnormal AB + MO4-rp2 standard conditions Fig. 3 from Shu et al., 2011
eye opaque, abnormal AB + MO4-rp2 standard conditions Fig. 3 from Shu et al., 2011
retinal cone cell photoreceptor outer segment absent, abnormal AB + MO4-rp2 standard conditions Fig. 4 from Shu et al., 2011
retinal rod cell photoreceptor outer segment absent, abnormal AB + MO4-rp2 standard conditions Fig. 4 from Shu et al., 2011
OTHER MO4-rp2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)