header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120216-7
Morpholino Name: MO1-sncb
Target: sncb (1)
Previous Name: sncb E2/I2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AATGTTGCATGACTTACCCACAAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-sncb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-sncb No data available
PHENOTYPE
Phenotype resulting from MO1-sncb
No data available

Phenotype of all Fish created by or utilizing MO1-sncb
OTHER MO1-sncb MORPHOLINO PAGES No links to external sites
CITATIONS (1)