header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-111209-7
Morpholino Name: MO2-twist1b
Target: twist1b (1)
Previous Name: twist1b atgMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTCTCGCGCGGGCTCTTCGGGCATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-twist1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-twist1b
Expressed Gene Anatomy Figures
col10a1a Fig. 5 with image from Yang et al., 2011
runx2b Fig. 4 with imageFig. 5 with image from Yang et al., 2011
sp7 Fig. 5 with image from Yang et al., 2011
PHENOTYPE
Phenotype resulting from MO2-twist1b
Phenotype of all Fish created by or utilizing MO2-twist1b
Genome Resources:
CITATIONS (1)