Morpholino

MO1-nus1

ID
ZDB-MRPHLNO-111209-1
Name
MO1-nus1
Previous Names
None
Target
Sequence
5' - ACACCATCTCATACAGCGAAGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nus1
No data available
Phenotype
Phenotype resulting from MO1-nus1
Phenotype Fish Figures
hindbrain increased accumulation hindbrain cholesterol, abnormal WT + MO1-nus1 Figure 3: with image,  Figure 4: with image from Yu et al., 2021
intersegmental vessel decreased amount, abnormal WT + MO1-nus1 Fig. 2 from Zhao et al., 2010
post-vent region increased accumulation motor neuron cholesterol, abnormal WT + MO1-nus1 Figure 3: with image,  Figure 4: with image from Yu et al., 2021
spinal cord increased accumulation spinal cord cholesterol, abnormal WT + MO1-nus1 Figure 3: with image,  Figure 4: with image from Yu et al., 2021
sprouting angiogenesis disrupted, abnormal WT + MO1-nus1 Fig. 2 from Zhao et al., 2010
whole organism Ab1-ngbr labeling decreased amount, abnormal WT + MO1-nus1 Figure 2: with image from Yu et al., 2021
whole organism Ab1-npc2 labeling decreased amount, abnormal WT + MO1-nus1 Figure 3: with image from Yu et al., 2021
whole organism swimming behavior process quality, abnormal WT + MO1-nus1 Figure 2: with image,  Figure 5: with image from Yu et al., 2021
Phenotype of all Fish created by or utilizing MO1-nus1
Phenotype Fish Conditions Figures
intersegmental vessel decreased amount, abnormal WT + MO1-nus1 standard conditions Fig. 2 from Zhao et al., 2010
post-vent region accumulation motor neuron cholesterol, ameliorated WT + MO1-nus1 chemical treatment by environment: beta-cyclodextrin Figure 4: with image from Yu et al., 2021
hindbrain increased accumulation hindbrain cholesterol, abnormal WT + MO1-nus1 control Figure 3: with image,  Figure 4: with image from Yu et al., 2021
spinal cord accumulation spinal cord cholesterol, ameliorated WT + MO1-nus1 chemical treatment by environment: beta-cyclodextrin Figure 4: with image from Yu et al., 2021
whole organism swimming behavior process quality, ameliorated WT + MO1-nus1 chemical treatment by environment: beta-cyclodextrin Figure 5: with image from Yu et al., 2021
post-vent region increased accumulation motor neuron cholesterol, abnormal WT + MO1-nus1 control Figure 3: with image,  Figure 4: with image from Yu et al., 2021
spinal cord increased accumulation spinal cord cholesterol, abnormal WT + MO1-nus1 control Figure 3: with image,  Figure 4: with image from Yu et al., 2021
sprouting angiogenesis disrupted, abnormal WT + MO1-nus1 standard conditions Fig. 2 from Zhao et al., 2010
whole organism Ab1-ngbr labeling decreased amount, abnormal WT + MO1-nus1 control Figure 2: with image from Yu et al., 2021
whole organism swimming behavior process quality, abnormal WT + MO1-nus1 control Figure 2: with image,  Figure 5: with image from Yu et al., 2021
hindbrain accumulation hindbrain cholesterol, ameliorated WT + MO1-nus1 chemical treatment by environment: beta-cyclodextrin Figure 4: with image from Yu et al., 2021
whole organism Ab1-npc2 labeling decreased amount, abnormal WT + MO1-nus1 control Figure 3: with image from Yu et al., 2021
whole organism Ab1-mcherry labeling amount, ameliorated pd1064Tg + MO1-nus1 chemical treatment by environment: beta-cyclodextrin Figure 4: with image from Yu et al., 2021
whole organism Ab1-mcherry labeling increased amount, abnormal pd1064Tg + MO1-nus1 control Figure 3: with image,  Figure 4: with image from Yu et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.