ZFIN ID: ZDB-MRPHLNO-111102-2
Morpholino Name: MO1-pax9
Target: pax9 (1)
Sequence:
5' - CCAAAGGCTGGCTCTAGTTATGCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pax9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pax9 No data available
PHENOTYPE
Phenotype resulting from MO1-pax9
Phenotype Figures
ceratobranchial 5 tooth decreased amount, abnormal Fig. 8 with image from Swartz et al., 2011
ethmoid cartilage chondrocyte disorganized, abnormal Fig. 8 with image from Swartz et al., 2011
hyomandibula bifurcated, abnormal Fig. 8 with image from Swartz et al., 2011
hyomandibula cylindrical, abnormal Fig. 8 with image from Swartz et al., 2011
hyomandibula decreased size, abnormal Fig. 8 with image from Swartz et al., 2011
neurocranium decreased length, abnormal Fig. 8 with image from Swartz et al., 2011
parasphenoid shape, abnormal Fig. 8 with image from Swartz et al., 2011
trabecula cranii unfused from neurocranium posterior region, abnormal Fig. 8 with image from Swartz et al., 2011
trabecula cranii chondrocyte disorganized, abnormal Fig. 8 with image from Swartz et al., 2011

Phenotype of all Fish created by or utilizing MO1-pax9
Phenotype Fish Conditions Figures
ceratobranchial 5 tooth decreased amount, abnormal AB + MO1-pax9 standard conditions Fig. 8 with image from Swartz et al., 2011
trabecula cranii chondrocyte disorganized, abnormal AB + MO1-pax9 standard conditions Fig. 8 with image from Swartz et al., 2011
parasphenoid shape, abnormal AB + MO1-pax9 standard conditions Fig. 8 with image from Swartz et al., 2011
trabecula cranii unfused from neurocranium posterior region, abnormal AB + MO1-pax9 standard conditions Fig. 8 with image from Swartz et al., 2011
neurocranium decreased length, abnormal AB + MO1-pax9 standard conditions Fig. 8 with image from Swartz et al., 2011
hyomandibula cylindrical, abnormal AB + MO1-pax9 standard conditions Fig. 8 with image from Swartz et al., 2011
hyomandibula bifurcated, abnormal AB + MO1-pax9 standard conditions Fig. 8 with image from Swartz et al., 2011
ethmoid cartilage chondrocyte disorganized, abnormal AB + MO1-pax9 standard conditions Fig. 8 with image from Swartz et al., 2011
hyomandibula decreased size, abnormal AB + MO1-pax9 standard conditions Fig. 8 with image from Swartz et al., 2011
OTHER MO1-pax9 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)