ZFIN ID: ZDB-MRPHLNO-111102-1
Morpholino Name: MO1-tgfb2
Target: tgfb2 (1)
Sequence:
5' - GGATTTACCTGGTAAAGCTCGATGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tgfb2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tgfb2 No data available
PHENOTYPE
Phenotype resulting from MO1-tgfb2
Phenotype Figures
ethmoid cartilage decreased length, abnormal Fig. 8 with image from Swartz et al., 2011
ethmoid cartilage shape, abnormal Fig. 8 with image from Swartz et al., 2011
mandibular arch skeleton decreased length, abnormal Fig. 8 with image from Swartz et al., 2011
mandibular arch skeleton shape, abnormal Fig. 8 with image from Swartz et al., 2011
Meckel's cartilage decreased size, abnormal Fig. 8 with image from Swartz et al., 2011
palate decreased size, abnormal Fig. 8 with image from Swartz et al., 2011
palate shape, abnormal Fig. 8 with image from Swartz et al., 2011
parasphenoid decreased length, abnormal Fig. 8 with image from Swartz et al., 2011
parasphenoid shape, abnormal Fig. 8 with image from Swartz et al., 2011
trabecula cranii decreased length, abnormal Fig. 8 with image from Swartz et al., 2011
trabecula cranii shape, abnormal Fig. 8 with image from Swartz et al., 2011

Phenotype of all Fish created by or utilizing MO1-tgfb2
Phenotype Fish Conditions Figures
trabecula cranii shape, abnormal AB + MO1-tgfb2 standard conditions Fig. 8 with image from Swartz et al., 2011
mandibular arch skeleton decreased length, abnormal AB + MO1-tgfb2 standard conditions Fig. 8 with image from Swartz et al., 2011
trabecula cranii decreased length, abnormal AB + MO1-tgfb2 standard conditions Fig. 8 with image from Swartz et al., 2011
parasphenoid decreased length, abnormal AB + MO1-tgfb2 standard conditions Fig. 8 with image from Swartz et al., 2011
palate shape, abnormal AB + MO1-tgfb2 standard conditions Fig. 8 with image from Swartz et al., 2011
palate decreased size, abnormal AB + MO1-tgfb2 standard conditions Fig. 8 with image from Swartz et al., 2011
mandibular arch skeleton shape, abnormal AB + MO1-tgfb2 standard conditions Fig. 8 with image from Swartz et al., 2011
parasphenoid shape, abnormal AB + MO1-tgfb2 standard conditions Fig. 8 with image from Swartz et al., 2011
Meckel's cartilage decreased size, abnormal AB + MO1-tgfb2 standard conditions Fig. 8 with image from Swartz et al., 2011
ethmoid cartilage shape, abnormal AB + MO1-tgfb2 standard conditions Fig. 8 with image from Swartz et al., 2011
ethmoid cartilage decreased length, abnormal AB + MO1-tgfb2 standard conditions Fig. 8 with image from Swartz et al., 2011
OTHER MO1-tgfb2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)