Morpholino

MO2-cnbpa

ID
ZDB-MRPHLNO-111101-3
Name
MO2-cnbpa
Previous Names
  • MO2-zff9 (1)
  • spl-MO (1)
Target
Sequence
5' - TATCTCTTCTTAGCTTACCCTTTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cnbpa
Phenotype
Phenotype resulting from MO2-cnbpa
Phenotype Fish Figures
anatomical structure cnbpa expression decreased amount, abnormal WT + MO2-cnbpa Fig. 6 with image from Armas et al., 2013
brain apoptotic, abnormal WT + MO2-cnbpa Fig. 4 from Margarit et al., 2014
brain necrotic, abnormal WT + MO2-cnbpa Fig. 1 from Weiner et al., 2011
brain development disrupted, abnormal WT + MO2-cnbpa Fig. 1 from Weiner et al., 2011
cell death increased occurrence, abnormal WT + MO2-cnbpa Fig. 1 from Weiner et al., 2011
ceratobranchial cartilage decreased amount, abnormal WT + MO2-cnbpa Fig. 5 from Margarit et al., 2014
ceratohyal cartilage decreased size, abnormal WT + MO2-cnbpa Fig. 5 from Margarit et al., 2014
ceratohyal cartilage malformed, abnormal WT + MO2-cnbpa Fig. 4 from Weiner et al., 2011
ceratohyal cartilage position, abnormal WT + MO2-cnbpa Fig. 5 from Margarit et al., 2014
chondrocyte morphology, abnormal WT + MO2-cnbpa Fig. 4 from Weiner et al., 2011
chordate embryonic development delayed, abnormal WT + MO2-cnbpa Fig. 4 from Margarit et al., 2014
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO2-cnbpa Fig. 5 from Margarit et al., 2014
ethmoid cartilage morphology, abnormal WT + MO2-cnbpa Fig. 4 from Weiner et al., 2011
eye tbx2b expression decreased amount, abnormal WT + MO2-cnbpa Fig. 6 with image from Armas et al., 2013
eye cnbpa expression decreased amount, abnormal WT + MO2-cnbpa Fig. 6 with image from Armas et al., 2013
eye decreased size, abnormal WT + MO2-cnbpa Fig. 4 from Margarit et al., 2014
Fig. 1 from Weiner et al., 2011
forebrain malformed, abnormal WT + MO2-cnbpa Fig. 1 from Weiner et al., 2011
hindbrain malformed, abnormal WT + MO2-cnbpa Fig. 1 from Weiner et al., 2011
hyosymplectic cartilage decreased size, abnormal WT + MO2-cnbpa Fig. 4 from Weiner et al., 2011
immature eye cnbpa expression decreased amount, abnormal WT + MO2-cnbpa Fig. 6 with image from Armas et al., 2013
Meckel's cartilage deformed, abnormal WT + MO2-cnbpa Fig. 4 from Weiner et al., 2011
midbrain malformed, abnormal WT + MO2-cnbpa Fig. 1 from Weiner et al., 2011
midbrain hindbrain boundary aplastic, abnormal WT + MO2-cnbpa Fig. 4 from Margarit et al., 2014
midbrain hindbrain boundary decreased size, abnormal WT + MO2-cnbpa Fig. 1 from Weiner et al., 2011
midbrain hindbrain boundary hypoplastic, abnormal WT + MO2-cnbpa Fig. 4 from Margarit et al., 2014
neurocranium cartilage element decreased size, abnormal WT + MO2-cnbpa Fig. 4 from Weiner et al., 2011
optic vesicle tbx2b expression decreased amount, abnormal WT + MO2-cnbpa Fig. 6 with image from Armas et al., 2013
palatoquadrate cartilage decreased size, abnormal WT + MO2-cnbpa Fig. 4 from Weiner et al., 2011
pharyngeal arch 1 decreased size, abnormal WT + MO2-cnbpa Fig. 4 from Weiner et al., 2011
pharyngeal arch 2 decreased size, abnormal WT + MO2-cnbpa Fig. 4 from Weiner et al., 2011
pharyngeal arch 3-7 disorganized, abnormal WT + MO2-cnbpa Fig. 4 from Weiner et al., 2011
retina malformed, abnormal WT + MO2-cnbpa Fig. 1 from Weiner et al., 2011
splanchnocranium morphology, abnormal WT + MO2-cnbpa Fig. 5 from Margarit et al., 2014
trabecular layer chondrocyte decreased amount, abnormal WT + MO2-cnbpa Fig. 4 from Weiner et al., 2011
whole organism tbx2b expression decreased amount, abnormal WT + MO2-cnbpa Fig. 4 from Armas et al., 2013
whole organism tp53 expression decreased amount, abnormal WT + MO2-cnbpa Fig. 4 from Armas et al., 2013
whole organism cnbpa expression decreased amount, abnormal WT + MO2-cnbpa Fig. 4 from Armas et al., 2013
whole organism smarca5 expression decreased amount, abnormal WT + MO2-cnbpa Fig. 4 from Armas et al., 2013
whole organism sox9b expression decreased amount, abnormal WT + MO2-cnbpa Fig. 4 from Armas et al., 2013
whole organism tfap2a expression decreased amount, abnormal WT + MO2-cnbpa Fig. 4 from Armas et al., 2013
whole organism wnt5b expression increased amount, abnormal WT + MO2-cnbpa Fig. 4 from Armas et al., 2013
whole organism cdkn1a expression increased amount, abnormal WT + MO2-cnbpa Fig. 4 from Armas et al., 2013
Phenotype of all Fish created by or utilizing MO2-cnbpa
Phenotype Fish Conditions Figures
forebrain malformed, abnormal WT + MO2-cnbpa standard conditions Fig. 1 from Weiner et al., 2011
ceratohyal cartilage decreased size, abnormal WT + MO2-cnbpa standard conditions Fig. 5 from Margarit et al., 2014
pharyngeal arch 2 decreased size, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Weiner et al., 2011
whole organism il6 expression decreased amount, abnormal WT + MO2-cnbpa chemical treatment by injection: lipopolysaccharide Fig. 8 with image from Lee et al., 2017
whole organism cdkn1a expression increased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Armas et al., 2013
eye cnbpa expression decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 6 with image from Armas et al., 2013
whole organism tfap2a expression decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Armas et al., 2013
anatomical structure cnbpa expression decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 6 with image from Armas et al., 2013
macrophage chemotaxis decreased occurrence, abnormal WT + MO2-cnbpa chemical treatment by injection: lipopolysaccharide Fig. 8 with image from Lee et al., 2017
chondrocyte morphology, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Weiner et al., 2011
hyosymplectic cartilage decreased size, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Weiner et al., 2011
neutrophil chemotaxis decreased occurrence, abnormal WT + MO2-cnbpa bacterial treatment by injection: Shigella flexneri Fig. 8 with image from Lee et al., 2017
trabecular layer chondrocyte decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Weiner et al., 2011
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO2-cnbpa standard conditions Fig. 5 from Margarit et al., 2014
chordate embryonic development delayed, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Margarit et al., 2014
whole organism tbx2b expression decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Armas et al., 2013
optic vesicle tbx2b expression decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 6 with image from Armas et al., 2013
whole organism wnt5b expression increased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Armas et al., 2013
brain development disrupted, abnormal WT + MO2-cnbpa standard conditions Fig. 1 from Weiner et al., 2011
neurocranium cartilage element decreased size, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Weiner et al., 2011
whole organism decreased life span, abnormal WT + MO2-cnbpa bacterial treatment by injection: Shigella flexneri Fig. 8 with image from Lee et al., 2017
Meckel's cartilage deformed, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Weiner et al., 2011
brain apoptotic, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Margarit et al., 2014
immature eye cnbpa expression decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 6 with image from Armas et al., 2013
ceratobranchial cartilage decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 5 from Margarit et al., 2014
whole organism cnbpa expression decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Armas et al., 2013
retina malformed, abnormal WT + MO2-cnbpa standard conditions Fig. 1 from Weiner et al., 2011
whole organism smarca5 expression decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Armas et al., 2013
whole organism tp53 expression decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Armas et al., 2013
ethmoid cartilage morphology, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Weiner et al., 2011
ceratohyal cartilage malformed, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Weiner et al., 2011
brain necrotic, abnormal WT + MO2-cnbpa standard conditions Fig. 1 from Weiner et al., 2011
whole organism sox9b expression decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Armas et al., 2013
cell death increased occurrence, abnormal WT + MO2-cnbpa standard conditions Fig. 1 from Weiner et al., 2011
midbrain hindbrain boundary decreased size, abnormal WT + MO2-cnbpa standard conditions Fig. 1 from Weiner et al., 2011
pharyngeal arch 1 decreased size, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Weiner et al., 2011
eye tbx2b expression decreased amount, abnormal WT + MO2-cnbpa standard conditions Fig. 6 with image from Armas et al., 2013
eye decreased size, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Margarit et al., 2014
Fig. 1 from Weiner et al., 2011
splanchnocranium morphology, abnormal WT + MO2-cnbpa standard conditions Fig. 5 from Margarit et al., 2014
ceratohyal cartilage position, abnormal WT + MO2-cnbpa standard conditions Fig. 5 from Margarit et al., 2014
pharyngeal arch 3-7 disorganized, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Weiner et al., 2011
midbrain malformed, abnormal WT + MO2-cnbpa standard conditions Fig. 1 from Weiner et al., 2011
midbrain hindbrain boundary aplastic, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Margarit et al., 2014
midbrain hindbrain boundary hypoplastic, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Margarit et al., 2014
hindbrain malformed, abnormal WT + MO2-cnbpa standard conditions Fig. 1 from Weiner et al., 2011
palatoquadrate cartilage decreased size, abnormal WT + MO2-cnbpa standard conditions Fig. 4 from Weiner et al., 2011
Citations