ZFIN ID: ZDB-MRPHLNO-110927-1
Morpholino Name: MO1-ddit3
Target: ddit3 (1)
Sequence:
5' - CGATTCCAGACGCTACTGACCTCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ddit3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ddit3 No data available
PHENOTYPE
Phenotype resulting from MO1-ddit3
No data available

Phenotype of all Fish created by or utilizing MO1-ddit3
Phenotype Fish Conditions Figures
vasculature hemorrhagic, abnormal gbf1tsu3994/tsu3994 + MO1-ddit3 standard conditions Fig. 9 from Chen et al., 2017
OTHER MO1-ddit3 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)