header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110823-4
Morpholino Name: MO1-fus
Target: fus (1)
Sequence:
5' - GGCCATAATCATTTGACGCCATGTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fus No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fus No data available
PHENOTYPE
Phenotype resulting from MO1-fus
Phenotype of all Fish created by or utilizing MO1-fus
Phenotype Fish Conditions Figures
neuromuscular junction development process quality, abnormal WT + MO1-fus standard conditions Fig. 3 from Armstrong et al., 2013
sensory perception of touch disrupted, abnormal WT + MO1-fus standard conditions Fig. 2 with image from Kabashi et al., 2011
neuromuscular synaptic transmission decreased process quality, abnormal WT + MO1-fus standard conditions Fig. 2Fig. 4 from Armstrong et al., 2013
neuromuscular synaptic transmission process quality, abnormal WT + MO1-fus standard conditions Fig. 2 from Armstrong et al., 2013
thigmotaxis process quality, abnormal WT + MO1-fus standard conditions Fig. 1 from Armstrong et al., 2013
larval locomotory behavior process quality, abnormal WT + MO1-fus standard conditions Fig. 1 from Armstrong et al., 2013
motor neuron axon decreased length, abnormal WT + MO1-fus standard conditions Fig. 2 with image from Kabashi et al., 2011
CaP motoneuron axon decreased length, abnormal ml2Tg + MO1-fus standard conditions Fig. 4 with imageFig. 5 from Chitramuthu et al., 2017
axon extension process quality, abnormal ml2Tg + MO1-fus standard conditions Fig. 4 with image from Chitramuthu et al., 2017
thigmotaxis decreased process quality, abnormal ml2Tg + MO1-fus standard conditions Fig. 5 from Chitramuthu et al., 2017
motor neuron axon decreased length, abnormal WT + MO1-fus + MO1-sod1 standard conditions text only from Kabashi et al., 2011
sensory perception of touch disrupted, abnormal WT + MO1-fus + MO1-sod1 standard conditions text only from Kabashi et al., 2011
sensory perception of touch disrupted, abnormal WT + MO1-fus + MO1-tardbp standard conditions Fig. 6 with image from Kabashi et al., 2011
motor neuron axon decreased length, abnormal WT + MO1-fus + MO1-tardbp standard conditions Fig. 6 with image from Kabashi et al., 2011
OTHER MO1-fus MORPHOLINO PAGESNo links to external sites
CITATIONS (4)