Morpholino

MO3-bmpr2b

ID

ZDB-MRPHLNO-110729-3

Name

MO3-bmpr2b

Previous Names

bmpr2b #1 (1)

Target

bmpr2b (1)

Sequence

5' - AGTTGATTCTGACCTTGTTTGACCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-bmpr2b

No data available

Phenotype

Phenotype resulting from MO3-bmpr2b

Phenotype	Fish	Figures
angiogenesis disrupted, abnormal	s843Tg + MO3-bmpr2b	Fig. 3, Fig. S5 from Wiley et al., 2011
caudal vein plexus decreased size, abnormal	s843Tg + MO3-bmpr2b	Fig. 3 from Wiley et al., 2011
thoracic duct has fewer parts of type lymphatic system endothelial cell, abnormal	s896Tg; y7Tg + MO3-bmpr2b	Fig. 1 from Kim et al., 2014
venous blood vessel morphogenesis disrupted, abnormal	s843Tg + MO3-bmpr2b	Fig. 3 from Wiley et al., 2011

Phenotype of all Fish created by or utilizing MO3-bmpr2b

Phenotype	Fish	Conditions	Figures
angiogenesis disrupted, abnormal	WT + MO3-bmpr2b	standard conditions	Fig. S5 from Wiley et al., 2011
angiogenesis disrupted, abnormal	s843Tg + MO3-bmpr2b	standard conditions	Fig. 3 from Wiley et al., 2011
caudal vein plexus decreased size, abnormal	s843Tg + MO3-bmpr2b	standard conditions	Fig. 3 from Wiley et al., 2011
venous blood vessel morphogenesis disrupted, abnormal	s843Tg + MO3-bmpr2b	standard conditions	Fig. 3 from Wiley et al., 2011
thoracic duct has fewer parts of type lymphatic system endothelial cell, abnormal	s896Tg; y7Tg + MO3-bmpr2b	standard conditions	Fig. 1 from Kim et al., 2014
caudal vein plexus decreased width, abnormal	y1Tg + MO3-bmpr2a + MO3-bmpr2b	standard conditions	Fig. 4 from Wakayama et al., 2015
caudal vein plexus malformed, abnormal	y1Tg + MO3-bmpr2a + MO3-bmpr2b	standard conditions	Fig. 4 from Wakayama et al., 2015
caudal vein plexus decreased width, abnormal	y1Tg + MO1-arhgef9b + MO3-bmpr2a + MO3-bmpr2b	standard conditions	Fig. 4 from Wakayama et al., 2015
caudal vein plexus malformed, abnormal	y1Tg + MO1-arhgef9b + MO3-bmpr2a + MO3-bmpr2b	standard conditions	Fig. 4 from Wakayama et al., 2015
caudal vein plexus malformed, abnormal	y1Tg + MO1-fmnl3 + MO3-bmpr2a + MO3-bmpr2b	standard conditions	Fig. S6 from Wakayama et al., 2015
caudal vein plexus decreased width, abnormal	y1Tg + MO1-fmnl3 + MO3-bmpr2a + MO3-bmpr2b	standard conditions	Fig. S6 from Wakayama et al., 2015
post-vent vasculature mislocalised, abnormal	fr13Tg; s843Tg + MO3-bmpr2b	heat shock	Fig. 3 from Wiley et al., 2011

Citations