Morpholino

MO1-esco2

ID
ZDB-MRPHLNO-110713-1
Name
MO1-esco2
Previous Names
  • esco2_ATG_MO (1)
Target
Sequence
5' - CTCTTTCGGGATAACATCTTCAATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-esco2
Phenotype
Phenotype resulting from MO1-esco2
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-esco2 Fig. 2 with imageFig. 4 with image from Mönnich et al., 2011
basihyal cartilage deformed, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
blood circulation disrupted, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
caudal fin curved, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
cell chromosome disorganized, abnormal WT + MO1-esco2 Fig. 4 with image from Mönnich et al., 2011
cell mitotic spindle deformed, abnormal WT + MO1-esco2 Fig. 4 with image from Mönnich et al., 2011
ceratobranchial cartilage decreased length, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
ceratobranchial cartilage decreased size, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
extension decreased thickness, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
eye decreased size, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
eye hypoplastic, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
head decreased size, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
head hypoplastic, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
heart edematous, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
hypobranchial cartilage decreased thickness, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
integument decreased pigmentation, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
mandibular arch skeleton aplastic, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
mitotic cell cycle increased occurrence, abnormal WT + MO1-esco2 Fig. 4 with image from Mönnich et al., 2011
negative regulation of TOR signaling increased occurrence, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
pectoral fin decreased length, abnormal WT + MO1-esco2 Fig. 3 with image from Mönnich et al., 2011
pectoral fin deformed, abnormal WT + MO1-esco2 Fig. 3 with image from Mönnich et al., 2011
pectoral fin cell condensed, abnormal WT + MO1-esco2 Fig. 3 with image from Mönnich et al., 2011
pectoral fin cell decreased size, abnormal WT + MO1-esco2 Fig. 3 with image from Mönnich et al., 2011
pericardial cavity edematous, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
pigmentation disrupted, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
post-vent region curved dorsal, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
somite disorganized, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
whole organism decreased size, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
whole organism shortened, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
Phenotype of all Fish created by or utilizing MO1-esco2
Phenotype Fish Conditions Figures
regenerating fin sema3d expression decreased amount, abnormal C32 + MO1-esco2 amputation: fin Fig. 10 with image from Banerji et al., 2016
regenerating fin decreased length, abnormal C32 + MO1-esco2 amputation: fin Fig. 4 with image from Banerji et al., 2016
regenerating fin gja1b expression decreased amount, abnormal C32 + MO1-esco2 amputation: fin Fig. 9 with image from Banerji et al., 2016
bone growth disrupted, abnormal C32 + MO1-esco2 amputation: fin Fig. 4 with image from Banerji et al., 2016
regenerating fin cell population proliferation decreased occurrence, abnormal C32 + MO1-esco2 amputation: fin Fig. 6 with image from Banerji et al., 2016
fin regeneration disrupted, abnormal C32 + MO1-esco2 amputation: fin Fig. 4 with image from Banerji et al., 2016
regenerating fin decreased length, abnormal C32 + MO1-esco2 amputation: fin, heat shock Fig. 12 with image from Banerji et al., 2016
regenerating fin hapln1a expression decreased amount, abnormal C32 + MO1-esco2 amputation: fin Fig. 10 with image from Banerji et al., 2016
whole organism shortened, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
caudal fin curved, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
pigmentation disrupted, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
head hypoplastic, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
basihyal cartilage deformed, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
integument decreased pigmentation, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
pectoral fin decreased length, abnormal WT + MO1-esco2 standard conditions Fig. 3 with image from Mönnich et al., 2011
eye decreased size, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
pectoral fin cell condensed, abnormal WT + MO1-esco2 standard conditions Fig. 3 with image from Mönnich et al., 2011
cell mitotic spindle deformed, abnormal WT + MO1-esco2 standard conditions Fig. 4 with image from Mönnich et al., 2011
heart edematous, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
pectoral fin deformed, abnormal WT + MO1-esco2 standard conditions Fig. 3 with image from Mönnich et al., 2011
cell chromosome disorganized, abnormal WT + MO1-esco2 standard conditions Fig. 4 with image from Mönnich et al., 2011
pectoral fin cell decreased size, abnormal WT + MO1-esco2 standard conditions Fig. 3 with image from Mönnich et al., 2011
ceratobranchial cartilage decreased length, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
head decreased size, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
extension decreased thickness, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
negative regulation of TOR signaling increased occurrence, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
pericardial cavity edematous, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
post-vent region curved dorsal, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
ceratobranchial cartilage decreased size, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
blood circulation disrupted, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
mandibular arch skeleton aplastic, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
apoptotic process increased occurrence, abnormal WT + MO1-esco2 standard conditions Fig. 2 with imageFig. 4 with image from Mönnich et al., 2011
somite disorganized, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
eye hypoplastic, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
hypobranchial cartilage decreased thickness, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
whole organism decreased size, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
mitotic cell cycle increased occurrence, abnormal WT + MO1-esco2 standard conditions Fig. 4 with image from Mönnich et al., 2011
regenerating fin length, ameliorated pd48Tg + MO1-esco2 amputation: fin, heat shock Fig. 12 with image from Banerji et al., 2016
regenerating fin caudal fin lepidotrichium decreased length, exacerbated gja1bb123/+ + MO1-esco2 amputation: caudal fin Fig. 6 from Banerji et al., 2017
regenerating fin decreased length, exacerbated gja1bb123/+ + MO1-esco2 amputation: caudal fin Fig. 6 from Banerji et al., 2017
Citations