Morpholino

MO3-tnnt2a

ID
ZDB-MRPHLNO-110616-1
Name
MO3-tnnt2a
Previous Names
  • TNNT2sp (1)
Target
Sequence
5' - TAGACACAGATGAACTCACAATTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-tnnt2a
Expressed Gene Anatomy Figures
nppa Fig. 1 from Becker et al., 2012
nppb Fig. 1 from Becker et al., 2012
Phenotype
Phenotype resulting from MO3-tnnt2a
Phenotype Fish Figures
atrium dilated, abnormal WT + MO3-tnnt2a Fig. 2 with image from Becker et al., 2011
cardiac muscle cell decreased area, abnormal f2Tg + MO3-tnnt2a Fig. 3 with image from Becker et al., 2011
cardiac muscle cell electric potential, abnormal WT + MO3-tnnt2a Fig. 4 with image from Becker et al., 2011
cardiac muscle cell increased amount, abnormal f2Tg + MO3-tnnt2a Fig. 3 with image from Becker et al., 2011
cardiac ventricle decreased diameter, abnormal WT + MO3-tnnt2a Fig. 2 with image from Becker et al., 2011
cardiac ventricle decreased functionality, abnormal WT + MO3-tnnt2a Fig. 2 with image from Becker et al., 2011
cardiac ventricle decreased size, abnormal WT + MO3-tnnt2a Fig. 2 with image from Becker et al., 2011
hormone activity decreased occurrence, abnormal WT + MO3-tnnt2a Fig. 5 with image from Becker et al., 2011
pericardium edematous, abnormal WT + MO3-tnnt2a Fig. 2 with image from Becker et al., 2011
regulation of cardiac muscle contraction by calcium ion signaling disrupted, abnormal WT + MO3-tnnt2a Fig. 4 with image from Becker et al., 2011
ventricular myocardium sarcomere disorganized, abnormal WT + MO3-tnnt2a Fig. 3 with image from Becker et al., 2011
Phenotype of all Fish created by or utilizing MO3-tnnt2a
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO3-tnnt2a standard conditions Fig. 2 with image from Becker et al., 2011
cardiac ventricle decreased diameter, abnormal WT + MO3-tnnt2a standard conditions Fig. 2 with image from Becker et al., 2011
ventricular myocardium sarcomere disorganized, abnormal WT + MO3-tnnt2a standard conditions Fig. 3 with image from Becker et al., 2011
regulation of cardiac muscle contraction by calcium ion signaling disrupted, abnormal WT + MO3-tnnt2a standard conditions Fig. 4 with image from Becker et al., 2011
cardiac ventricle decreased size, abnormal WT + MO3-tnnt2a standard conditions Fig. 2 with image from Becker et al., 2011
atrium dilated, abnormal WT + MO3-tnnt2a standard conditions Fig. 2 with image from Becker et al., 2011
cardiac ventricle decreased functionality, abnormal WT + MO3-tnnt2a standard conditions Fig. 2 with image from Becker et al., 2011
hormone activity decreased occurrence, abnormal WT + MO3-tnnt2a standard conditions Fig. 5 with image from Becker et al., 2011
cardiac muscle cell electric potential, abnormal WT + MO3-tnnt2a standard conditions Fig. 4 with image from Becker et al., 2011
cardiac muscle cell increased amount, abnormal f2Tg + MO3-tnnt2a standard conditions Fig. 3 with image from Becker et al., 2011
cardiac muscle cell decreased area, abnormal f2Tg + MO3-tnnt2a standard conditions Fig. 3 with image from Becker et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.