ZFIN ID: ZDB-MRPHLNO-110607-3
Morpholino Name: MO1-ncor2
Target: ncor2 (1)
Sequence:
5' - GTTATTCTGCGAGCACAGAAAATCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ncor2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ncor2
Expressed Gene Anatomy Figures
dll4 Fig. 4 from Wei et al., 2014
efnb2a Fig. 4 from Wei et al., 2014
fosab Fig. 2 from Wei et al., 2014
myb Fig. 1Fig. 3Fig. 6 from Wei et al., 2014
rag1 Fig. 1 from Wei et al., 2014
runx1 Fig. 1Fig. 3Fig. 5Fig. 6 from Wei et al., 2014
vegfd Fig. 5 from Wei et al., 2014
PHENOTYPE
Phenotype resulting from MO1-ncor2
Phenotype Figures
artery increased size, abnormal Fig. 4 from Wei et al., 2014
dorsal aorta increased size, abnormal Fig. 4 from Wei et al., 2014
hematopoietic stem cell decreased amount, abnormal Fig. 5 with image from Tijssen et al., 2011
histone H3-K9 acetylation increased process quality, abnormal Fig. 2 from Wei et al., 2014
histone H3-K27 acetylation increased process quality, abnormal Fig. 2 from Wei et al., 2014
nucleate erythrocyte decreased amount, abnormal Fig. 5 with image from Tijssen et al., 2011
thrombocyte decreased amount, abnormal Fig. 5 with image from Tijssen et al., 2011

Phenotype of all Fish created by or utilizing MO1-ncor2
Phenotype Fish Conditions Figures
histone H3-K9 acetylation increased process quality, abnormal AB + MO1-ncor2 standard conditions Fig. 2 from Wei et al., 2014
histone H3-K27 acetylation increased process quality, abnormal AB + MO1-ncor2 standard conditions Fig. 2 from Wei et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-ncor2 standard conditions Fig. 5 with image from Tijssen et al., 2011
thrombocyte decreased amount, abnormal la2Tg + MO1-ncor2 standard conditions Fig. 5 with image from Tijssen et al., 2011
hematopoietic stem cell decreased amount, abnormal la2Tg + MO1-ncor2 standard conditions Fig. 5 with image from Tijssen et al., 2011
artery increased size, abnormal y1Tg + MO1-ncor2 control Fig. 4 from Wei et al., 2014
dorsal aorta increased size, abnormal y1Tg + MO1-ncor2 control Fig. 4 from Wei et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal pku6Tg; zf169Tg + MO1-ncor2 standard conditions Fig. 1Fig. 3 from Wei et al., 2014
histone H3-K27 acetylation increased process quality, abnormal AB + MO1-hdac3 + MO1-ncor2 standard conditions Fig. 2 from Wei et al., 2014
histone H3-K9 acetylation increased process quality, abnormal AB + MO1-hdac3 + MO1-ncor2 standard conditions Fig. 2 from Wei et al., 2014
OTHER MO1-ncor2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)