header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110523-6
Morpholino Name: MO2-mir92a
Targets: mir92a-1 (1), mir92a-2 (1)
Previous Name: MO92a1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACAGGCCGGGACAAGTGCAATA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets both mir92a-1 and mir92a-2.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-mir92a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-mir92a
Expressed Gene Anatomy Figures
bmp2b Fig. S5 with image from Ning et al., 2013
bmp4 Fig. S5 with image from Ning et al., 2013
col2a1a Fig. 2 with image from Ning et al., 2013
dlx2a Fig. 2 with image from Ning et al., 2013
foxd3 Fig. 2 with image from Ning et al., 2013
gsc Fig. 2 with image from Ning et al., 2013
hand2 Fig. 2 with image from Ning et al., 2013
nog3 Fig. 5 with image from Ning et al., 2013
sox9a Fig. 2 with image from Ning et al., 2013
PHENOTYPE
Phenotype resulting from MO2-mir92a
No data available

Phenotype of all Fish created by or utilizing MO2-mir92a
Phenotype Fish Conditions Figures
chondrocranium chondrocyte differentiation process quality, abnormal WT + MO2-mir92a standard conditions Fig. 2 with image from Ning et al., 2013
pectoral fin endoskeletal disc decreased size, abnormal WT + MO2-mir92a standard conditions Fig. S1 with image from Ning et al., 2013
ceratohyal cartilage absent, abnormal WT + MO2-mir92a standard conditions Fig. 1 with image from Ning et al., 2013
pectoral fin morphology, abnormal WT + MO2-mir92a standard conditions Fig. S1 with image from Ning et al., 2013
Meckel's cartilage absent, abnormal WT + MO2-mir92a standard conditions Fig. 1 with image from Ning et al., 2013
basihyal cartilage absent, abnormal WT + MO2-mir92a standard conditions Fig. 1 with image from Ning et al., 2013
parachordal cartilage absent, abnormal WT + MO2-mir92a standard conditions Fig. 1 with image from Ning et al., 2013
pharyngeal arch chondroblast disorganized, abnormal WT + MO2-mir92a standard conditions Fig. S2 with image from Ning et al., 2013
palatoquadrate cartilage absent, abnormal WT + MO2-mir92a standard conditions Fig. 1 with image from Ning et al., 2013
head decreased size, abnormal WT + MO2-mir92a standard conditions Fig. 1 with image from Ning et al., 2013
ethmoid cartilage absent, abnormal WT + MO2-mir92a standard conditions Fig. 1 with image from Ning et al., 2013
cleithrum absent, abnormal WT + MO2-mir92a standard conditions Fig. S1 with image from Ning et al., 2013
eye decreased size, abnormal WT + MO2-mir92a standard conditions Fig. 1 with image from Ning et al., 2013
occipital region absent, abnormal WT + MO2-mir92a standard conditions Fig. 1 with image from Ning et al., 2013
hyosymplectic cartilage absent, abnormal WT + MO2-mir92a standard conditions Fig. 1 with image from Ning et al., 2013
pectoral fin decreased size, abnormal WT + MO2-mir92a standard conditions Fig. S1 with image from Ning et al., 2013
trabecula cranii absent, abnormal WT + MO2-mir92a standard conditions Fig. 1 with image from Ning et al., 2013
pharyngeal arch absent, abnormal WT + MO2-mir92a standard conditions Fig. 1 with imageFig. 7 with image from Ning et al., 2013
pharyngeal arch decreased size, abnormal WT + MO2-mir92a standard conditions Fig. 1 with image from Ning et al., 2013
scapulocoracoid absent, abnormal WT + MO2-mir92a standard conditions Fig. S1 with image from Ning et al., 2013
pharyngeal arch decreased size, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
pectoral fin morphology, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. S1 with image from Ning et al., 2013
scapulocoracoid absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. S1 with image from Ning et al., 2013
palatoquadrate cartilage absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
ethmoid cartilage absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
ceratohyal cartilage absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
head decreased size, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
cleithrum absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. S1 with image from Ning et al., 2013
pectoral fin decreased size, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. S1 with image from Ning et al., 2013
pharyngeal arch absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
occipital region absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
Meckel's cartilage absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
pectoral fin endoskeletal disc decreased size, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. S1 with image from Ning et al., 2013
eye decreased size, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
pharyngeal arch absent, abnormal npas4lm378/m378 + MO2-mir92a standard conditions Fig. S2 with image from Ning et al., 2013
endoderm formation disrupted, abnormal AB + MO1-mir92a-1 + MO1-mir92a-2 + MO1-mir92b + MO2-mir92a + MO2-mir92b standard conditions Fig. 2 with image from Li et al., 2011
left/right pattern formation disrupted, abnormal AB + MO1-mir92b + MO2-mir92a standard conditions Fig. 2 with image from Li et al., 2011
ceratohyal cartilage chondrocyte differentiation process quality, abnormal y1Tg + MO2-mir92a standard conditions Fig. 2 with image from Ning et al., 2013
pharyngeal arch decreased size, abnormal y1Tg + MO2-mir92a standard conditions Fig. S3 with image from Ning et al., 2013
palatoquadrate cartilage chondrocyte differentiation process quality, abnormal y1Tg + MO2-mir92a standard conditions Fig. 2 with image from Ning et al., 2013
palatoquadrate cartilage chondroblast disorganized, abnormal y1Tg + MO2-mir92a standard conditions Fig. 2 with image from Ning et al., 2013
pharyngeal arch chondroblast disorganized, abnormal y1Tg + MO2-mir92a standard conditions Fig. 2 with image from Ning et al., 2013
pharyngeal arch mitotic cell cycle arrested, abnormal y1Tg + MO2-mir92a standard conditions Fig. 3 with image from Ning et al., 2013
pharyngeal arch absent, abnormal y1Tg + MO2-mir92a standard conditions Fig. S3 with image from Ning et al., 2013
pharyngeal arch cell population proliferation decreased process quality, abnormal y1Tg + MO2-mir92a standard conditions Fig. 3 with image from Ning et al., 2013
pharyngeal arch apoptotic process increased process quality, abnormal y1Tg + MO2-mir92a standard conditions Fig. 3 with image from Ning et al., 2013
chondrocranium chondrocyte differentiation process quality, abnormal y1Tg + MO2-mir92a standard conditions Fig. 2 with image from Ning et al., 2013
ceratohyal cartilage chondroblast disorganized, abnormal y1Tg + MO2-mir92a standard conditions Fig. 2 with image from Ning et al., 2013
pharyngeal arch apoptotic process increased process quality, abnormal y1Tg + MO2-mir92a + MO4-tp53 standard conditions Fig. 3 with image from Ning et al., 2013
Kupffer's vesicle cilium decreased length, abnormal s870Tg + MO1-mir92b + MO2-mir92a standard conditions Fig. 2 with image from Li et al., 2011
Kupffer's vesicle cell decreased amount, abnormal s870Tg + MO1-mir92b + MO2-mir92a standard conditions Fig. 2 with image from Li et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal s870Tg + MO1-mir92b + MO2-mir92a standard conditions Fig. 2 with image from Li et al., 2011
Genome Resources:
CITATIONS (2)