Morpholino

MO1-parp3

ID
ZDB-MRPHLNO-110324-2
Name
MO1-parp3
Previous Names
  • Parp3 (MO1) (1)
Target
Sequence
5' - ATGCTGCCCTTCTCTTGGGTGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-parp3
Expressed Gene Anatomy Figures
crestin Fig. 5 with image from Rouleau et al., 2011
dlx3b Fig. 6 with image from Rouleau et al., 2011
dlx4b Fig. 6 with image from Rouleau et al., 2011
neurod1 Fig. 7 with image from Rouleau et al., 2011
nkx2.4b Fig. 7 with image from Rouleau et al., 2011
parp3 Fig. 1 with image from Rouleau et al., 2011
sox9a Fig. 6 with image from Rouleau et al., 2011
Phenotype
Phenotype resulting from MO1-parp3
Phenotype Fish Figures
inner ear aplastic, abnormal WT + MO1-parp3 Fig. 1 with image from Rouleau et al., 2011
locomotory behavior decreased occurrence, abnormal WT + MO1-parp3 text only from Rouleau et al., 2011
median fin fold immature, abnormal WT + MO1-parp3 Fig. 1 with image from Rouleau et al., 2011
median fin fold structure, abnormal WT + MO1-parp3 Fig. 1 with image from Rouleau et al., 2011
neural crest cell development disrupted, abnormal WT + MO1-parp3 Fig. 5 with image from Rouleau et al., 2011
pectoral fin aplastic, abnormal WT + MO1-parp3 Fig. 1 with image from Rouleau et al., 2011
pigmentation decreased occurrence, abnormal WT + MO1-parp3 Fig. 1 with image from Rouleau et al., 2011
post-vent region increased curvature, abnormal WT + MO1-parp3 Fig. 1 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Rouleau et al., 2011
whole organism dead, abnormal WT + MO1-parp3 text only from Rouleau et al., 2011
whole organism decreased length, abnormal WT + MO1-parp3 Fig. 1 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Rouleau et al., 2011
Phenotype of all Fish created by or utilizing MO1-parp3
Phenotype Fish Conditions Figures
median fin fold immature, abnormal WT + MO1-parp3 standard conditions Fig. 1 with image from Rouleau et al., 2011
post-vent region increased curvature, abnormal WT + MO1-parp3 standard conditions Fig. 1 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Rouleau et al., 2011
pigmentation decreased occurrence, abnormal WT + MO1-parp3 standard conditions Fig. 1 with image from Rouleau et al., 2011
locomotory behavior decreased occurrence, abnormal WT + MO1-parp3 standard conditions text only from Rouleau et al., 2011
pectoral fin aplastic, abnormal WT + MO1-parp3 standard conditions Fig. 1 with image from Rouleau et al., 2011
inner ear aplastic, abnormal WT + MO1-parp3 standard conditions Fig. 1 with image from Rouleau et al., 2011
median fin fold structure, abnormal WT + MO1-parp3 standard conditions Fig. 1 with image from Rouleau et al., 2011
whole organism decreased length, abnormal WT + MO1-parp3 standard conditions Fig. 1 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Rouleau et al., 2011
whole organism dead, abnormal WT + MO1-parp3 standard conditions text only from Rouleau et al., 2011
neural crest cell development disrupted, abnormal WT + MO1-parp3 standard conditions Fig. 5 with image from Rouleau et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.