ZFIN ID: ZDB-MRPHLNO-110304-6
Morpholino Name: MO2-pitpnb
Target: pitpnb (1)
Previous Name: Pitpnb MO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTGATGAGCACCATCTTCTTTCCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-pitpnb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-pitpnb No data available
PHENOTYPE
Phenotype resulting from MO2-pitpnb
Phenotype Figures
retinal cone cell photoreceptor outer segment decreased amount, abnormal Fig. 6 from Ile et al., 2010
retinal outer nuclear layer disorganized, abnormal Fig. 6 from Ile et al., 2010
retinal pigmented epithelium distance retinal outer nuclear layer, abnormal Fig. 6 from Ile et al., 2010

Phenotype of all Fish created by or utilizing MO2-pitpnb
Phenotype Fish Conditions Figures
retinal pigmented epithelium distance retinal outer nuclear layer, abnormal AB + MO2-pitpnb standard conditions Fig. 6 from Ile et al., 2010
retinal cone cell photoreceptor outer segment decreased amount, abnormal AB + MO2-pitpnb standard conditions Fig. 6 from Ile et al., 2010
retinal outer nuclear layer disorganized, abnormal AB + MO2-pitpnb standard conditions Fig. 6 from Ile et al., 2010
OTHER MO2-pitpnb MORPHOLINO PAGESNo links to external sites
CITATIONS (1)