ZFIN ID: ZDB-MRPHLNO-110304-4
Morpholino Name: MO2-noto
Target: noto (1)
Previous Name: MO2-flh

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTAAGCTCTTCCGGGAATCTGCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-noto No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-noto
Expressed Gene Anatomy Figures
col2a1a Fig. 8 with image from Dal-Pra et al., 2011
foxa2 Fig. S5 with image from Dal-Pra et al., 2011
foxa3 Fig. S5 with image from Dal-Pra et al., 2011
im:7144261 Fig. 8 with image from Dal-Pra et al., 2011
myf5 Fig. 8 with imageFig. S5 with image from Dal-Pra et al., 2011
noto Fig. 8 with image from Dal-Pra et al., 2011
twist2 Fig. 8 with imageFig. S5 with image from Dal-Pra et al., 2011
PHENOTYPE
Phenotype resulting from MO2-noto
Phenotype Figures
axial chorda mesoderm decreased width, abnormal Fig. 8 with imageFig. S5 with image from Dal-Pra et al., 2011
floor plate disorganized, abnormal Fig. 8 with imageFig. S5 with image from Dal-Pra et al., 2011
hypochord aplastic, abnormal Fig. S5 with image from Dal-Pra et al., 2011
hypochord disorganized, abnormal Fig. 8 with image from Dal-Pra et al., 2011
notochord aplastic, abnormal Fig. S5 with image from Dal-Pra et al., 2011
notochord disorganized, abnormal Fig. 8 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal Fig. 8 with imageFig. S5 with image from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal Fig. S5 with image from Dal-Pra et al., 2011
somite fused with somite, abnormal Fig. S5 with image from Dal-Pra et al., 2011

Phenotype of all Fish created by or utilizing MO2-noto
Phenotype Fish Conditions Figures
floor plate disorganized, abnormal WT + MO2-noto standard conditions Fig. 8 with imageFig. S5 with image from Dal-Pra et al., 2011
notochord aplastic, abnormal WT + MO2-noto standard conditions Fig. S5 with image from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal WT + MO2-noto standard conditions Fig. S5 with image from Dal-Pra et al., 2011
somite fused with somite, abnormal WT + MO2-noto standard conditions Fig. S5 with image from Dal-Pra et al., 2011
hypochord disorganized, abnormal WT + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal WT + MO2-noto standard conditions Fig. 8 with imageFig. S5 with image from Dal-Pra et al., 2011
axial chorda mesoderm decreased width, abnormal WT + MO2-noto standard conditions Fig. 8 with imageFig. S5 with image from Dal-Pra et al., 2011
hypochord aplastic, abnormal WT + MO2-noto standard conditions Fig. S5 with image from Dal-Pra et al., 2011
notochord disorganized, abnormal WT + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
notochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
hypochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
floor plate aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
OTHER MO2-noto MORPHOLINO PAGESNo links to external sites
CITATIONS (1)