ZFIN ID: ZDB-MRPHLNO-110304-2
Morpholino Name: MO2-foxa3
Target: foxa3 (1)
Previous Name: MO-gamma1-FoxA3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCTCAACATCCCCAAATAAAGTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-foxa3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-foxa3 No data available
PHENOTYPE
Phenotype resulting from MO2-foxa3
No data available

Phenotype of all Fish created by or utilizing MO2-foxa3
Phenotype Fish Conditions Figures
hatching gland aplastic, abnormal WT + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. 2 with imageFig. S7 with image from Dal-Pra et al., 2011
anterior axial hypoblast morphology, abnormal WT + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 2 with image from Dal-Pra et al., 2011
notochord disorganized, abnormal WT + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 2 with image from Dal-Pra et al., 2011
axial chorda mesoderm decreased width, abnormal WT + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with image from Dal-Pra et al., 2011
prechordal plate poorly differentiated, abnormal WT + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 2 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal WT + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with image from Dal-Pra et al., 2011
axial chorda mesoderm decreased width, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with imageFig. 8 with image from Dal-Pra et al., 2011
somite fused with somite, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with image from Dal-Pra et al., 2011
notochord posterior region truncated, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. S2 with image from Dal-Pra et al., 2011
notochord cell decreased size, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. S1 with image from Dal-Pra et al., 2011
hypochord decreased length, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. S2 with image from Dal-Pra et al., 2011
notochord cell mislocalised, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. S1 with image from Dal-Pra et al., 2011
hypochord disorganized, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. 8 with imageFig. S2 with image from Dal-Pra et al., 2011
floor plate disorganized, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. 8 with imageFig. S2 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with imageFig. 8 with image from Dal-Pra et al., 2011
floor plate cell elongated, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. S1 with image from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with image from Dal-Pra et al., 2011
floor plate decreased length, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. S2 with image from Dal-Pra et al., 2011
notochord disorganized, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. 8 with imageFig. S2 with image from Dal-Pra et al., 2011
hypochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3 standard conditions Fig. S2 with image from Dal-Pra et al., 2011
notochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3 standard conditions Fig. S2 with image from Dal-Pra et al., 2011
floor plate aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3 standard conditions Fig. S2 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
hypochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
floor plate aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
notochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
OTHER MO2-foxa3 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)