header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110223-4
Morpholino Name: MO5-crb2a
Target: crb2a (1)
Previous Name: MO5-crb2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAGAAAGAATAAACTCACCCCATTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-crb2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-crb2a
Expressed Gene Anatomy Figures
her4.1 Fig. 4 with image from Ohata et al., 2011
PHENOTYPE
Phenotype resulting from MO5-crb2a
No data available

Phenotype of all Fish created by or utilizing MO5-crb2a
No data available
OTHER MO5-crb2a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)