ZFIN ID: ZDB-MRPHLNO-110216-8
Morpholino Name: MO1-slc4a1b
Target: slc4a1b (1)
Previous Name: zslc4a1b-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTTCGCAGACTCATTCATCTCCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation-blocker
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-slc4a1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-slc4a1b
Expressed Gene Anatomy Figures
slc4a1b Fig. 11 from Lee et al., 2011
PHENOTYPE
Phenotype resulting from MO1-slc4a1b
Phenotype of all Fish created by or utilizing MO1-slc4a1b
Genome Resources:
CITATIONS (2)