ZFIN ID: ZDB-MRPHLNO-110126-4
Morpholino Name: MO2-git2a
Target: git2a (1)
Sequence:
5' - CAGGAAAGTCATTTTCATACCTTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO. Targets the exon 4–intron 4 splice donor site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-git2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-git2a No data available
PHENOTYPE
Phenotype resulting from MO2-git2a
Phenotype Figures
cell migration involved in gastrulation disrupted, abnormal text only from Yu et al., 2011
epiboly involved in gastrulation with mouth forming second disrupted, abnormal text only from Yu et al., 2011

Phenotype of all Fish created by or utilizing MO2-git2a
Phenotype Fish Conditions Figures
epiboly involved in gastrulation with mouth forming second disrupted, abnormal AB + MO2-git2a standard conditions text only from Yu et al., 2011
cell migration involved in gastrulation disrupted, abnormal AB + MO2-git2a standard conditions text only from Yu et al., 2011
OTHER MO2-git2a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)