Morpholino

MO1-slc2a3a

ID

ZDB-MRPHLNO-110119-1

Name

MO1-slc2a3a

Previous Names

Target

Sequence

5' - CTCCATCGTGCCGGAGTGGAAACGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-slc2a3a

Expressed Gene	Anatomy	Figures
kdrl	(not) eye	Fig. 2 from Zheng et al., 2010

Phenotype

Phenotype resulting from MO1-slc2a3a

Phenotype	Fish	Figures
blood circulation disrupted, abnormal	WT + MO1-slc2a3a	Fig. Video 5 from Zheng et al., 2010
blood vessel permeable, abnormal	WT + MO1-slc2a3a	Fig. 3 from Zheng et al., 2010
blood vessel endothelium adherens junction decreased object quality, abnormal	WT + MO1-slc2a3a	Fig. 2 from Zheng et al., 2010
blood vessel endothelium bicellular tight junction decreased object quality, abnormal	WT + MO1-slc2a3a	Fig. 2 from Zheng et al., 2010
brain edematous, abnormal	WT + MO1-slc2a3a	Fig. 3 from Zheng et al., 2010
brain vasculature decreased functionality, abnormal	WT + MO1-slc2a3a	Fig. Video 5 from Zheng et al., 2010
glucose import decreased process quality, abnormal	WT + MO1-slc2a3a	Fig. 1 from Zheng et al., 2010
maintenance of blood-brain barrier disrupted, abnormal	WT + MO1-slc2a3a	Fig. 2 from Zheng et al., 2010

Phenotype of all Fish created by or utilizing MO1-slc2a3a

Phenotype	Fish	Conditions	Figures
maintenance of blood-brain barrier disrupted, abnormal	WT + MO1-slc2a3a	standard conditions	Fig. 2 from Zheng et al., 2010
blood vessel endothelium bicellular tight junction decreased object quality, abnormal	WT + MO1-slc2a3a	standard conditions	Fig. 2 from Zheng et al., 2010
glucose import decreased process quality, abnormal	WT + MO1-slc2a3a	standard conditions	Fig. 1 from Zheng et al., 2010
blood vessel permeable, abnormal	WT + MO1-slc2a3a	standard conditions	Fig. 3 from Zheng et al., 2010
blood circulation disrupted, abnormal	WT + MO1-slc2a3a	standard conditions	Fig. Video 5 from Zheng et al., 2010
brain edematous, abnormal	WT + MO1-slc2a3a	standard conditions	Fig. 3 from Zheng et al., 2010
blood vessel endothelium adherens junction decreased object quality, abnormal	WT + MO1-slc2a3a	standard conditions	Fig. 2 from Zheng et al., 2010
brain vasculature decreased functionality, abnormal	WT + MO1-slc2a3a	standard conditions	Fig. Video 5 from Zheng et al., 2010

Citations