Morpholino

MO2-cfl1

ID
ZDB-MRPHLNO-110118-4
Name
MO2-cfl1
Previous Names
  • tMO1 (1)
Target
Sequence
5' - CATGGCTGTGTCTCTGTGCTAGTCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cfl1
Expressed Gene Anatomy Figures
ctslb Fig. 8 with image,  Fig. 9 with image from Lin et al., 2010
dlx3b Fig. 8 with image from Lin et al., 2010
lft2 Fig. 7 from Zhang et al., 2016
myl7 Fig. 7 from Zhang et al., 2016
Phenotype
Phenotype resulting from MO2-cfl1
Phenotype Fish Figures
actin polymerization or depolymerization process quality, abnormal AB/TU + MO2-cfl1 Fig. 4 with image from Lin et al., 2010
blastoderm filamentous actin increased amount, abnormal AB/TU + MO2-cfl1 Fig. 4 with image from Lin et al., 2010
cell migration involved in gastrulation process quality, abnormal AB/TU + MO2-cfl1 Fig. 4 with image,  Fig. 7 with image from Lin et al., 2010
cell projection organization disrupted, abnormal AB/TU + MO2-cfl1 Fig. 10 with image from Lin et al., 2010
cell-cell adhesion involved in gastrulation decreased occurrence, abnormal AB/TU + MO2-cfl1 Fig. 6 with image,  Fig. 7 with image from Lin et al., 2010
convergent extension involved in axis elongation decreased process quality, abnormal AB/TU + MO2-cfl1 Fig. 8 with image from Lin et al., 2010
DEL circular, abnormal AB/TU + MO2-cfl1 Fig. 7 with image from Lin et al., 2010
DEL detached from EVL, abnormal AB/TU + MO2-cfl1 Fig. 6 with image,  Fig. 7 with image from Lin et al., 2010
dorsal convergence decreased process quality, abnormal AB/TU + MO2-cfl1 Fig. 8 with image from Lin et al., 2010
embryonic heart tube left/right pattern formation decreased occurrence, abnormal AB + MO2-cfl1 Fig. 7 from Zhang et al., 2016
epiboly involved in gastrulation with mouth forming second process quality, abnormal AB/TU + MO2-cfl1 Fig. 2 with image,  Fig. T1 with image from Lin et al., 2010
heart tube displaced to whole organism right side, abnormal AB + MO2-cfl1 Fig. 7 from Zhang et al., 2016
heart tube mislocalised medially, abnormal AB + MO2-cfl1 Fig. 7 from Zhang et al., 2016
hypoblast cell projection decreased amount, abnormal AB/TU + MO2-cfl1 Fig. 10 with image from Lin et al., 2010
Kupffer's vesicle cilium increased length, abnormal AB + MO2-cfl1 Fig. 7 from Zhang et al., 2016
pericardium edematous, abnormal AB + MO2-cfl1 Fig. 7 from Zhang et al., 2016
prechordal plate cell projection decreased amount, abnormal AB/TU + MO2-cfl1 Fig. 10 with image from Lin et al., 2010
pseudopodium organization disrupted, abnormal AB/TU + MO2-cfl1 Fig. 10 with image from Lin et al., 2010
whole organism curved, abnormal AB + MO2-cfl1 Fig. 7 from Zhang et al., 2016
whole organism axis decreased length, abnormal AB/TU + MO2-cfl1 Fig. 8 with image from Lin et al., 2010
whole organism axis increased width, abnormal AB/TU + MO2-cfl1 Fig. 8 with image from Lin et al., 2010
Phenotype of all Fish created by or utilizing MO2-cfl1
Phenotype Fish Conditions Figures
whole organism curved, abnormal AB + MO2-cfl1 standard conditions Fig. 7 from Zhang et al., 2016
heart tube mislocalised medially, abnormal AB + MO2-cfl1 standard conditions Fig. 7 from Zhang et al., 2016
Kupffer's vesicle cilium increased length, abnormal AB + MO2-cfl1 standard conditions Fig. 7 from Zhang et al., 2016
pericardium edematous, abnormal AB + MO2-cfl1 standard conditions Fig. 7 from Zhang et al., 2016
heart tube displaced to whole organism right side, abnormal AB + MO2-cfl1 standard conditions Fig. 7 from Zhang et al., 2016
embryonic heart tube left/right pattern formation decreased occurrence, abnormal AB + MO2-cfl1 standard conditions Fig. 7 from Zhang et al., 2016
DEL circular, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 7 with image from Lin et al., 2010
actin polymerization or depolymerization process quality, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 4 with image from Lin et al., 2010
convergent extension involved in axis elongation decreased process quality, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 8 with image from Lin et al., 2010
dorsal convergence decreased process quality, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 8 with image from Lin et al., 2010
cell migration involved in gastrulation process quality, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 4 with image,  Fig. 7 with image from Lin et al., 2010
DEL detached from EVL, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 6 with image,  Fig. 7 with image from Lin et al., 2010
prechordal plate cell projection decreased amount, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 10 with image from Lin et al., 2010
hypoblast cell projection decreased amount, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 10 with image from Lin et al., 2010
whole organism axis decreased length, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 8 with image from Lin et al., 2010
epiboly involved in gastrulation with mouth forming second process quality, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 2 with image,  Fig. T1 with image from Lin et al., 2010
cell projection organization disrupted, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 10 with image from Lin et al., 2010
cell-cell adhesion involved in gastrulation decreased occurrence, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 6 with image,  Fig. 7 with image from Lin et al., 2010
whole organism axis increased width, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 8 with image from Lin et al., 2010
pseudopodium organization disrupted, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 10 with image from Lin et al., 2010
blastoderm filamentous actin increased amount, abnormal AB/TU + MO2-cfl1 standard conditions Fig. 4 with image from Lin et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.