header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110111-1
Morpholino Name: MO2-eve1
Target: eve1 (1)
Previous Name: eveMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTGTAGGCTACTTACGCATTTTGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-eve1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-eve1 No data available
PHENOTYPE
Phenotype resulting from MO2-eve1
No data available

Phenotype of all Fish created by or utilizing MO2-eve1
Phenotype Fish Conditions Figures
caudal fin duplicated, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 7 with image from Seebald et al., 2011
tail bud duplicated, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 7 with image from Seebald et al., 2011
somite increased width, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 7 with image from Seebald et al., 2011
tail bud mislocalised, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 7 with image from Seebald et al., 2011
embryonic pattern specification process quality, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 5 with image from Seebald et al., 2011
caudal fin mislocalised, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 7 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-vent + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-vent + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
BMP signaling pathway involved in mesodermal cell fate specification process quality, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal AB + MO1-ved + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
BMP signaling pathway involved in mesodermal cell fate specification process quality, abnormal AB + MO1-ved + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
BMP signaling pathway involved in mesodermal cell fate specification process quality, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
OTHER MO2-eve1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)