ZFIN ID: ZDB-MRPHLNO-101228-4
Morpholino Name: MO4-msna
Target: msna (1)
Previous Name: moesin-a-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGGTCTCTTCCTTCACGAATGTGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets 5'UTR.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-msna No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-msna No data available
PHENOTYPE
Phenotype resulting from MO4-msna
No data available

Phenotype of all Fish created by or utilizing MO4-msna
No data available
OTHER MO4-msna MORPHOLINO PAGESNo links to external sites
CITATIONS (1)