ZFIN ID: ZDB-MRPHLNO-101122-1
Morpholino Name: MO1-rp2
Target: rp2 (1)
Previous Name: AUG1-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTTGGAGAAGAAGCACCCCATTTAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO, targets 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rp2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rp2
Expressed Gene Anatomy Figures
spaw Fig. 6 from Hurd et al., 2010
PHENOTYPE
Phenotype resulting from MO1-rp2
Phenotype Figures
brain hydrocephalic, abnormal Fig. 6 from Desvignes et al., 2015
Fig. 6 from Hurd et al., 2010
caudal fin bent, abnormal Fig. 6 from Desvignes et al., 2015
determination of heart left/right asymmetry process quality, abnormal Fig. 6 from Desvignes et al., 2015
Fig. 6 from Hurd et al., 2010
embryo development delayed, abnormal Fig. 6Fig. S3 from Desvignes et al., 2015
extension decreased size, abnormal Fig. 6 from Desvignes et al., 2015
eye degenerate, abnormal Fig. 6 from Desvignes et al., 2015
eye shape, abnormal Fig. 6 from Desvignes et al., 2015
heart malformed, abnormal Fig. 6 from Hurd et al., 2010
heart looping process quality, abnormal Fig. 6 from Desvignes et al., 2015
Fig. 6Fig. 7 from Hurd et al., 2010
lateral mesoderm bilateral symmetry, abnormal Fig. 6 from Hurd et al., 2010
pericardium edematous, abnormal Fig. 6 from Desvignes et al., 2015
pronephric duct cystic, abnormal Fig. 6 from Hurd et al., 2010

Phenotype of all Fish created by or utilizing MO1-rp2
Phenotype Fish Conditions Figures
brain hydrocephalic, abnormal AB + MO1-rp2 standard conditions Fig. 6 from Desvignes et al., 2015
eye shape, abnormal AB + MO1-rp2 standard conditions Fig. 6 from Desvignes et al., 2015
caudal fin bent, abnormal AB + MO1-rp2 standard conditions Fig. 6 from Desvignes et al., 2015
extension decreased size, abnormal AB + MO1-rp2 standard conditions Fig. 6 from Desvignes et al., 2015
eye degenerate, abnormal AB + MO1-rp2 standard conditions Fig. 6 from Desvignes et al., 2015
pericardium edematous, abnormal AB + MO1-rp2 standard conditions Fig. 6 from Desvignes et al., 2015
embryo development delayed, abnormal AB + MO1-rp2 standard conditions Fig. 6Fig. S3 from Desvignes et al., 2015
heart malformed, abnormal WT + MO1-rp2 standard conditions Fig. 6 from Hurd et al., 2010
brain hydrocephalic, abnormal WT + MO1-rp2 standard conditions Fig. 6 from Hurd et al., 2010
pronephric duct cystic, abnormal WT + MO1-rp2 standard conditions Fig. 6 from Hurd et al., 2010
lateral mesoderm bilateral symmetry, abnormal WT + MO1-rp2 standard conditions Fig. 6 from Hurd et al., 2010
determination of heart left/right asymmetry process quality, abnormal WT + MO1-rp2 standard conditions Fig. 6 from Hurd et al., 2010
determination of heart left/right asymmetry process quality, abnormal b1229Tg + MO1-rp2 standard conditions Fig. 6 from Desvignes et al., 2015
heart looping process quality, abnormal b1229Tg + MO1-rp2 standard conditions Fig. 6 from Desvignes et al., 2015
heart looping process quality, abnormal twu34Tg + MO1-rp2 standard conditions Fig. 6Fig. 7 from Hurd et al., 2010
OTHER MO1-rp2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)