Morpholino

MO1-grhl1

ID
ZDB-MRPHLNO-101108-7
Name
MO1-grhl1
Previous Names
  • grhl1-splice-MO (1)
Target
Sequence
5' - CTTTGATGAGAGCTTCACCTTTTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
SPlice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-grhl1
Expressed Gene Anatomy Figures
atp1b1b Fig. 6 with image from Jänicke et al., 2010
atp6v1aa Fig. 6 with image from Jänicke et al., 2010
col1a1a Fig. 2 with image from Jänicke et al., 2010
grhl1 Fig. 2 with image,  Fig. 5 with image,  Fig. 6 with image from Jänicke et al., 2010
pvalb8 Fig. 6 with image from Jänicke et al., 2010
tp63 Fig. 2 with image,  Fig. 6 with image from Jänicke et al., 2010
Phenotype
Phenotype resulting from MO1-grhl1
Phenotype Fish Figures
hair cell apoptotic process increased occurrence, abnormal AB + MO1-grhl1 Fig. 3 with image from Liu et al., 2015
neuromast hair cell apoptotic, abnormal AB + MO1-grhl1 Fig. 3 with image from Liu et al., 2015
neuromast hair cell decreased amount, abnormal AB + MO1-grhl1 Fig. 2 with image from Liu et al., 2015
neuromast hair cell desmosome damaged, abnormal AB + MO1-grhl1 Fig. 3 with image from Liu et al., 2015
neuromast hair cell desmosome disorganized, abnormal AB + MO1-grhl1 Fig. 4 with image from Liu et al., 2015
otolith amount, abnormal AB + MO1-grhl1 Fig. 2 with image from Liu et al., 2015
otolith decreased size, abnormal AB + MO1-grhl1 Fig. 2 with image from Liu et al., 2015
otolith mislocalised, abnormal AB + MO1-grhl1 Fig. 2 with image from Liu et al., 2015
semicircular canal malformed, abnormal AB + MO1-grhl1 Fig. 2 with image from Liu et al., 2015
sensory perception of sound disrupted, abnormal AB + MO1-grhl1 Fig. 4 with image from Liu et al., 2015
startle response disrupted, abnormal AB + MO1-grhl1 Fig. 4 with image from Liu et al., 2015
Phenotype of all Fish created by or utilizing MO1-grhl1
Phenotype Fish Conditions Figures
otolith decreased size, abnormal AB + MO1-grhl1 standard conditions Fig. 2 with image from Liu et al., 2015
startle response disrupted, abnormal AB + MO1-grhl1 standard conditions Fig. 4 with image from Liu et al., 2015
semicircular canal malformed, abnormal AB + MO1-grhl1 standard conditions Fig. 2 with image from Liu et al., 2015
otolith amount, abnormal AB + MO1-grhl1 standard conditions Fig. 2 with image from Liu et al., 2015
neuromast hair cell decreased amount, abnormal AB + MO1-grhl1 standard conditions Fig. 2 with image from Liu et al., 2015
neuromast hair cell desmosome damaged, abnormal AB + MO1-grhl1 standard conditions Fig. 3 with image from Liu et al., 2015
neuromast hair cell desmosome disorganized, abnormal AB + MO1-grhl1 standard conditions Fig. 4 with image from Liu et al., 2015
hair cell apoptotic process increased occurrence, abnormal AB + MO1-grhl1 standard conditions Fig. 3 with image from Liu et al., 2015
neuromast hair cell apoptotic, abnormal AB + MO1-grhl1 standard conditions Fig. 3 with image from Liu et al., 2015
otolith mislocalised, abnormal AB + MO1-grhl1 standard conditions Fig. 2 with image from Liu et al., 2015
sensory perception of sound disrupted, abnormal AB + MO1-grhl1 standard conditions Fig. 4 with image from Liu et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.