ZFIN ID: ZDB-MRPHLNO-101108-6
Morpholino Name: MO10-jag2b
Target: jag2b (1)
Previous Name: MO10-jag2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTCGTCAACATCTGAAAACAGAATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO10-jag2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO10-jag2b No data available
PHENOTYPE
Phenotype resulting from MO10-jag2b
No data available

Phenotype of all Fish created by or utilizing MO10-jag2b
No data available
OTHER MO10-jag2b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)